A Word From The Nerds

I went (a long time ago it has to be admitted) to what people call an ‘old-fashioned’ grammar school. It wasn’t really old-fashioned – we didn’t wear wigs and frock coats – it just put great emphasis in getting its kids into good universities. To this end we were, at an early stage, split into scientists and the rest (aka arts students). It was a bit more severe even than that because the ‘scientists’ were sub-divided: those considered bright did Maths, Chemistry and Physics whilst the rest did Biology instead of Maths (or anything instead of Maths). All of which was consistent with the view that biologists – and that includes medics – could get by without being able to add up. That was a long time ago, of course, but to some extent the myth lives on. In tutorials with first year medical students I found an ace way of inducing nervous breakdowns was to ask them to do a sum in their heads (“Put that calculator away Biggs minor”).

But times do change and when I asked a doctor the other day which branches of medical science required maths, he paused for moment and then said “All of them.” By that he meant that pretty well every area of current research relies on the application of mathematics. We hear much about DNA sequencing, genomics and its various offshoots but all of these need ‘bioinformaticists’ (whizzos at sums) to extract the useful grains form the vast mass of data generated. Much the same may be said of research in what are called imaging techniques – developing methods of detecting tumours – and there is now a vast subject in itself of ‘systems biology’ in which mathematical modeling is applied to complex biological events (e.g., signalling within cells) with the aim of being able to reconstruct what goes on – what folk like to call a holistic approach. A variation on this theme is studying how large populations of cells behave – for example, tumour cells when exposed to an anti-cancer drug. And that’s an important matter: if your drug kills off every cancer cell bar one but that one happens to be very good at reproducing itself, before long you’ll be back to square one. The way to avoid going round in circles is to detect and interrogate individual survivor cells to find out why they are such good escape artists.

Girls will be girls

All of which brings us to Franziska Michor. Born in Vienna of a michor2-d5f528c0eec02b1797c3028e48c17598.pngmathematician father who, she has recounted, told her and her sister that they had either to study maths or marry a mathematician. Sounds a frightening version of tradition to me – and it had perhaps the intended effect on the girls: frantic sprints to the nearest Department of Mathematics. That’s a bit unfair. As they say, some of my best friends are mathematicians – so they’re not at all the stereotypical distrait, inarticulate, socially inept weirdos. Although most of them are.

But Fräulein Michor was clearly one of the exceptions. She’s now a professor at the Dana-Farber Cancer Institute and Harvard School of Public Health in Boston and, with colleagues, she’s had a go at an important question: when cancer cells become resistant to a drug, is it because they acquire new mutations in their DNA or is it that some cells are already resistant and they are the ones that survive and grow. Their results suggest the simple answer is ‘the latter’ – resistant clones are present before treatment and they’re the survivors. So the upshot is clear but the route to it was very clever – not least because the maths involved in teasing out the answer is positively frightening. Fortunately (medics breathe a sigh of relief!) we can ignore the horrors of ‘Stochastic mathematical modeling using a nonhomogeneous continuous-time multitype birth–death process’ – yes, really – and just look at the biology, which was ingenious enough. To get at the answer they developed a tagging system that tracked the individual fates of over one million barcoded cancer cells under drug treatment.

Nerd picBarcoding cells. Strings of DNA 30 base pairs in length and of random sequence are artificially synthesized (coloured bars). These fragments are inserted in the genomes of viruses. The viruses infect cancer cells in culture and, after drug treatment, cells that survive (drug resistant) are harvested, their DNA is extracted and barcode DNA is detected (redrawn from Bhang et al. 2015).

Check this out!

Barcodes were pioneered by two young Americans, Bernard Silver and Norman Woodland, for automatically reading product information at checkouts and nowadays they’re used to mark everything from bananas to railway wagons and plane tickets. Their most familiar form is essentially a one-dimensional array that Woodland said he came up with by drawing Morse code in sand and just extending the dots and dashes to make narrow and wide lines.

120px-UPC-A-036000291452128px-PhotoTAN_mit_Orientierungsmarkierungen.svgbarcode n

 

 

 

 

Cellular barcoding uses the same idea but the ‘label’ is an artificial DNA sequence. Such is the power of the genetic code that a random string made up of 30 of its four distinct units (A, C, G & T) can essentially make an infinite number of different tags. Just like those on supermarket labels, two different codes look the same at first glance:

ACTCTGTGTCTCAGTGTGAGTGTCTGACTG

ACTGTCTGAGACAGAGAGTGTGACAGTCAG

The tags are made in an oligonucleotide synthesizer (a machine that sticks the units together) and then incorporated into virus backbones, just as we described for immunotherapy. The viruses (+ barcodes) then infect cells in culture, these are treated with a drug and the survivors present after a few weeks have their barcode DNAs sequenced. The deal here is that the number of different barcodes detected reflects the proportion of the original cell population that survived – and it indeed turned out that it’s very rare, pre-existing clones that are drug resistant. For one of the cell lines (derived from a human lung cancer) about one in 2,000 of the starting cell population showed resistance to the drug erlotinib.

Why?

The obvious question then is ‘What’s special about those few cells that they can thumb their noses at drugs that kill off most of their pals?’ To begin to get answers Bhang, Michor and colleagues noted that, for the lung cancer line, resistance to erlotinib occurs in cells that have multiple copies of a gene called MET – which makes a signalling protein. Exposing the cells to erlotinib and a MET inhibitor (crizotinib) greatly reduced the size of the resistant population (to one in 200,000).

This still leaves the question of the genetic alterations in that 0.0005% – and of course, finding drugs to target them. A further point is that this was a study of cells grown in the lab and it’s not possible to use this system in patients – but it could be used in mice to follow the development of implanted human tumours. If the causes of resistance can be tracked down it would open the way to using combinations of drugs that target both the bulk of tumour cells and the small sub-populations in which resistance lurks. That upshot would bring us to clinicians at the bedside (non-mathematicians!) – but not before running up a big debt to the maths geeks and in this case to a Viennese Dad who really did know best (offspring of the world please note!).

References

Bhang, H.C. et al. (2015). Studying clonal dynamics in response to cancer therapy using high-complexity barcoding. Nature Medicine 21, 440-448.

Advertisements

Blowing Up Cancer

To adapt the saying of the sometime British Prime Minister Harold Wilson, a month is a long time in cancer research. {I know, you’ve forgotten – as well you might. He was PM from 1964 to 1970 and again from 1974 to 1976. His actual words were “A week is a long time in politics”}. When I started to write the foregoing Self Helps (Parts 1 & 2) I had absolutely no intention of mentioning the subject of today’s sermon – viral immunotherapy. But how times change and a recent report has hit the headlines – so here goes.

The reason for my reticence is that this is not a new field – far from it. Folk have been trying to target tumour cells with active viruses for twenty years but efforts have foundered to the extent that the new report is the first time in the western world that a phase III trial (when a drug or treatment is first tested on large groups of people) of cancer “virotherapy” has definitively shown benefit for patients with cancer, although a virus (H101) made by the Shanghai Sunway Biotech Co. was licensed in China in 2005 for the treatment of a range of cancers.

Hard bit already done

I appreciate that getting the hang of immunotherapy in the two Self Helps wasn’t a total doddle – but it was worth it, wasn’t it, bearing in mind we’re dealing with life and death here. My friend and correspondent Rachel Bown had to resort to her GCSE biology notes (since she met me I think she keeps them on the coffee table) but is now up to speed.

Fortunately this bit is pretty easy to follow – it’s just an extension of the viral jiggery-pokery we met in Self Help Part 2. There we saw that using ‘disabled’ viruses is a neat way of getting new genetic material into cells. The viruses have key bits of their genome (genetic material) knocked out – so they don’t have any nasty effects and don’t replicate (make more of themselves) once inside cells. Inserting new bits of DNA carrying a therapeutic gene turns them into a molecular delivery service.

Going viral

In virotherapy there’s one extra wrinkle: the viruses, though ‘disabled’, still retain the capacity to replicate – and this has two effects. First, more and more virus particles (virions) are made in an infected cell until eventually it can hold no more and it bursts. The cell is done for – but a secondary effect is that the newly-made virions spill out and drift off to infect other cells. This amplifies the effect of the initial injection of virus and, in principle, will continue as long as there are cells to infect.

A new tool

The virus used is herpes simplex (HSV-1) of the relatively harmless type that causes cold sores and, increasingly frequently, genital herpes. The reason for this choice is that sometimes, not very often, science gets lucky and Mother Nature comes up with a helping hand. For HSV-1 it was the completely unexpected discovery that when you knock out one of its genes the virus becomes much more effective at replicating in tumour cells than in normal cells. That’s a megagalactic plus because, in effect, it means the virus targets tumour cells, thereby overcoming one of the great barriers to cancer therapy. In this study another viral gene was also deleted, which increases the immune response against infected tumour cells.

All this cutting and pasting (aka genetic engineering) is explained in entertaining detail in Betrayed by Nature but for now all that matters is that you end up with a virus that:

  1. Gets into tumour cells much more efficiently than into normal cells,
  2. Makes the protein encoded by the therapeutic gene, and
  3. Replicates in the cells that take it up until eventually they are so full of new viruses they go pop.

The finished product, if you can get your tongue round it, goes by the name of talimogene laherparepvec, mercifully shortened by the authors to T-VEC (made by Amgen). So T-VEC mounts a two-pronged attack – what the military would call a pincer movement. Infected tumour cells are killed (they’re ‘lysed’ by viral overload) and the inserted gene makes a protein that soups up the immune response – called GM-CSF (granulocyte macrophage colony-stimulating factor). The name doesn’t matter: what’s important is that it’s a human signaling molecule that stimulates the immune system, the overall result being production of tumour-specific T cells.

Fig. 1 Viral Therapy

Virotherapy. Model of a virus (top). The knobs represent proteins that enable the virus to stick to cells. Below: sequence of injecting viruses that are taken up by tumour cells that eventually burst to release new virions that diffuse to infect other tumour cells.

And the results?

The phase III trial, led by Robert Andtbacka, Howard Kaufman and colleagues from Rutgers Cancer Institute of New Jersey, involved 64 research centres worldwide and 436 patients with aggressive, inoperable malignant melanoma who received either an injection of T-VEC or a control immunotherapy. Just over 16% of the T-VEC group showed a durable response of more than six months, compared with 2% given the control treatment. About 10% of the patients treated had “complete remission”, with no detectable cancer remaining – considered a cure if the patient is still cancer-free five years after diagnosis.

Maybe this time?

We started with Harold Wilson and it was in between his two spells in Number 10 that President Nixon declared his celebrated ‘War on Cancer’, aimed at bringing the major forms of the disease under control within a decade or two. It didn’t happen, as we might have guessed. Back in 1957 in The Black Cloud the astrophysicist Sir Fred Hoyle has the line ‘I cannot understand what makes scientists tick. They are always wrong and they always go on.’ To be fair, it was a science fiction novel and the statement clearly is only partly true. But it’s not far off and in cancer there’s been rather few of the media’s beloved ‘breakthroughs’ and a great deal of random shuffling together with, overall, some progress in specific areas. Along the bumpy highway there have, of course, been moments of high excitement when some development or other has briefly looked like the answer to a maiden’s prayer. But with time all of these have fallen, if not by the wayside, at least into their due place as yet another small step for man. The nearest to a “giant leap for mankind” has probably been coming up with the means to sequence DNA on an industrial scale that is now having a massive impact on the cancer game.

When Liza Minnelli (as Sally Bowles in Cabaret) sings Maybe this time your heart goes out to the poor thing, though your head knows it’ll all end in tears. But this time, maybe, just maybe, the advent of cancer immunotherapy in its various forms will turn out to be a new era. Let us fervently hope so but, even if it does, the results of this Phase III trial show that a long struggle lies ahead before treatments arrive that have most patients responding.

We began Self Help – Part 1 with the wonderful William Coley and there’s no better way to pause in this story than with his words – reminding us of a bygone age when the scientist’s hand could brandish an artistic pen and space-saving editors hadn’t been invented:

“While the results have not been as satisfactory as one who is seeking perfection could wish, … when it comes to the consideration of a new method of treatment for malignant tumours, we must not wonder that a profession with memories overburdened with a thousand and one much-vaunted remedies that have been tried and failed takes little interest in any new method and shows less inclination to examine into its merits. Cold indifference is all it can expect, and rightly too, until it has something beside novelty to offer in its favour.”

References

Mohr, I. and Gluzman, Y. (1996). A herpesvirus genetic element which affects translation in the absence of the viral GADD34 function. The EMBO Journal 15, 4759–66.

Andtbacka, R.H.I. et al. (2015). Talimogene Laherparepvec Improves Durable Response Rate in Patients With Advanced Melanoma. 10.1200/JCO.2014.58.3377