Transparently Obvious

 

Scientists have a well-earned reputation for doing odd things – by which I mean coming up with a ‘finding’ that leaves me, at least, wondering how, in the name of all things wonderful, they ever got money to do their study. To be fair, it’s the ‘social scientists’ – rather than the ‘real’ lot – that excel in this field. An example? Take your pick. They crop up pretty well weekly in the press. I liked the one on how something called ‘personal congruence’ affects marriage survival. The more congruence you and your partner have the better your chances: if, over time, your congruence goes down the tubes, your relationship will surely follow. But what on earth is congruence? Seemingly it’s a ‘state of agreeing.’ Lots of it equals harmony, loss of it = discord. So, it is what you remember from school geometry: it means more or less equal. Wow! Now I’ve grasped the upshot of this ‘study’: agreeably happy couples tend to make it: pairings based on whacking each other with frying pans tend to end in tears. Why didn’t they tell us earlier!!

Axolotl

   Axolotl

Fortunately, in my world, even the weirdies usually turn out to be quite sensible, once you know what’s going on. Many moons ago a girl-friend asked me if I’d like to see her collection of axolotls. Not having a clue what she was on about I gave it an excited ‘yes please’. Whilst it mayn’t have been what I was hoping for (I was very young back then), I immediately fell in love with these wonderful amphibians that I’d never heard of as she explained what I should have known: these ‘Mexican walking fish’ have very large embryos which makes them particularly useful for studying development. These sensational salamanders really are amazing, not least because they can regenerate entire limbs after they’ve been chopped off.

More recently there’s been another unlikely recruit to the scientific armoury: the zebrafish – a tropical freshwater fish from the Himalayas. This mighty minnow was the first vertebrate to be cloned which led to its being genetically modified to give a transparent variety. That’s all good fun but what on earth is the point of a see-through fish? Well, in Betrayed by Nature we pointed out that you can actually watch tumours growing in transparent zebrafish and we got so excited by that we even included a photo – kindly provided by Richard White of the Dana Farber Cancer Institute in Boston. The cancer was a melanoma which had grown into a black mass about 1 cm in diameter in the fish’s body after a small number of tumour cells had been injected a couple of weeks earlier.

And the driver is …

Nearly 15 years ago, just as the first complete sequence of human DNA was being unveiled, Mike Stratton and his colleagues at the Sanger Centre in Cambridge discovered a mutation that arises in about two-thirds of all malignant melanomas. It’s in a gene called BRAF. The protein made by the gene is an enzyme that’s part of a signalling pathway that pushes cells to divide. The mutation changes the shape of BRAF protein so it works 24/7 as an enzyme: the pathway is no longer controlled by a message from the world beyond the cell. It’s a ‘molecular switch’ that’s been flipped by mutation to act as a cancer ‘driver.’

Richard White and his colleagues showed that the same mutation drove melanoma development in zebrafish and that when it did so something remarkable happened. As the tumours got going they turned on a gene that is normally only required during the first 72 hours after fertilization. The gene’s called crestin – because it’s switched on in a tissue called the neural crest where crestin protein helps to form the bony support for the gills. After that it’s switched off and crestin protein never appears again. Except in the pigment-containing cells called melanocytes when they are turning into a tumour.

Seeing the problem

In a great example of how science can work, Charles Kaufman, Leonard Zon and colleagues in Boston and other centres took this finding and made another transgenic variant of the transparent zebrafish. They cut out the stretch of DNA that controls whether the crestin gene is ‘on’ or ‘off’ and hooked it up to a gene that makes a green fluorescent protein (GFP). Result: when the machinery of a cell turns crestin on, GFP is also made – and the cell glows green under the appropriate light. Hence you would expect to see a glowing neural crest early in development but thereafter a non-glowing fish. Unless it has a melanoma. And Zon & Co saw exactly that. Because green fluorescent protein glows so brightly, a single cell shows up and it turned out that whenever one green cell was detected it always went on to expand and grow into a large melanoma tumour.

1 cell to mel

Tracking a single cell turning into a tumour over 6, 9, 11.5 and 17 weeks. The green fluorescence marks an early developmental gene (crestin) being re-activated in a melanoma tumour (from Kaufman et al., 2016).

But why might it be useful to ‘see’ single cells?

Since the original finding by Stratton & Co more detailed studies have confirmed that mutated BRAF is indeed an important ‘driver’ in about two-thirds of malignant melanoma. But here’s the odd thing: lots of melanocytes (the cells that can turn into melanomas) have mutated BRAF – but they don’t become cancerous. Why not? And there’s something else: it’s well-known that ultraviolet radiation in sunlight causes many melanomas and they do indeed often arise on exposed skin – but they can also crop up in places where, as they say, the sun doesn’t shine. So clearly, important though mutated BRAF and sunlight are, there’s something else that’s critical for malignant melanoma.

The Kaufman experiment was remarkable, not least because it offers a way of getting at this key question of what happens in a cell to kick it off as a tumour, by comparison with a near neighbour that remains ‘normal.’

The tumour cells used in this model carry mutated BRAF and another gene, P53, was knocked out. This gives two major genetic drivers and it may be that further genetic changes aren’t needed. If that’s the case, then the decisive push must come either from epigenetic changes (that affect gene expression without change in DNA sequence) or from adaptations of the tumour microenvironment to provide an optimal niche for expansion. At the moment we don’t know very much about these critical areas of cancer biology. Being able to follow single cells may lead us to the answers.

Keep your eye on the transparent minnows!

Reference

Kaufman, C.K., Zon, L.I. et al. (2016). A zebrafish melanoma model reveals emergence of neural crest identity during melanoma initiation. Science 351, Issue 6272, pp. DOI: 10.1126/science.aad2197

 

Advertisements

A Word From The Nerds

I went (a long time ago it has to be admitted) to what people call an ‘old-fashioned’ grammar school. It wasn’t really old-fashioned – we didn’t wear wigs and frock coats – it just put great emphasis in getting its kids into good universities. To this end we were, at an early stage, split into scientists and the rest (aka arts students). It was a bit more severe even than that because the ‘scientists’ were sub-divided: those considered bright did Maths, Chemistry and Physics whilst the rest did Biology instead of Maths (or anything instead of Maths). All of which was consistent with the view that biologists – and that includes medics – could get by without being able to add up. That was a long time ago, of course, but to some extent the myth lives on. In tutorials with first year medical students I found an ace way of inducing nervous breakdowns was to ask them to do a sum in their heads (“Put that calculator away Biggs minor”).

But times do change and when I asked a doctor the other day which branches of medical science required maths, he paused for moment and then said “All of them.” By that he meant that pretty well every area of current research relies on the application of mathematics. We hear much about DNA sequencing, genomics and its various offshoots but all of these need ‘bioinformaticists’ (whizzos at sums) to extract the useful grains form the vast mass of data generated. Much the same may be said of research in what are called imaging techniques – developing methods of detecting tumours – and there is now a vast subject in itself of ‘systems biology’ in which mathematical modeling is applied to complex biological events (e.g., signalling within cells) with the aim of being able to reconstruct what goes on – what folk like to call a holistic approach. A variation on this theme is studying how large populations of cells behave – for example, tumour cells when exposed to an anti-cancer drug. And that’s an important matter: if your drug kills off every cancer cell bar one but that one happens to be very good at reproducing itself, before long you’ll be back to square one. The way to avoid going round in circles is to detect and interrogate individual survivor cells to find out why they are such good escape artists.

Girls will be girls

All of which brings us to Franziska Michor. Born in Vienna of a michor2-d5f528c0eec02b1797c3028e48c17598.pngmathematician father who, she has recounted, told her and her sister that they had either to study maths or marry a mathematician. Sounds a frightening version of tradition to me – and it had perhaps the intended effect on the girls: frantic sprints to the nearest Department of Mathematics. That’s a bit unfair. As they say, some of my best friends are mathematicians – so they’re not at all the stereotypical distrait, inarticulate, socially inept weirdos. Although most of them are.

But Fräulein Michor was clearly one of the exceptions. She’s now a professor at the Dana-Farber Cancer Institute and Harvard School of Public Health in Boston and, with colleagues, she’s had a go at an important question: when cancer cells become resistant to a drug, is it because they acquire new mutations in their DNA or is it that some cells are already resistant and they are the ones that survive and grow. Their results suggest the simple answer is ‘the latter’ – resistant clones are present before treatment and they’re the survivors. So the upshot is clear but the route to it was very clever – not least because the maths involved in teasing out the answer is positively frightening. Fortunately (medics breathe a sigh of relief!) we can ignore the horrors of ‘Stochastic mathematical modeling using a nonhomogeneous continuous-time multitype birth–death process’ – yes, really – and just look at the biology, which was ingenious enough. To get at the answer they developed a tagging system that tracked the individual fates of over one million barcoded cancer cells under drug treatment.

Nerd picBarcoding cells. Strings of DNA 30 base pairs in length and of random sequence are artificially synthesized (coloured bars). These fragments are inserted in the genomes of viruses. The viruses infect cancer cells in culture and, after drug treatment, cells that survive (drug resistant) are harvested, their DNA is extracted and barcode DNA is detected (redrawn from Bhang et al. 2015).

Check this out!

Barcodes were pioneered by two young Americans, Bernard Silver and Norman Woodland, for automatically reading product information at checkouts and nowadays they’re used to mark everything from bananas to railway wagons and plane tickets. Their most familiar form is essentially a one-dimensional array that Woodland said he came up with by drawing Morse code in sand and just extending the dots and dashes to make narrow and wide lines.

120px-UPC-A-036000291452128px-PhotoTAN_mit_Orientierungsmarkierungen.svgbarcode n

 

 

 

 

Cellular barcoding uses the same idea but the ‘label’ is an artificial DNA sequence. Such is the power of the genetic code that a random string made up of 30 of its four distinct units (A, C, G & T) can essentially make an infinite number of different tags. Just like those on supermarket labels, two different codes look the same at first glance:

ACTCTGTGTCTCAGTGTGAGTGTCTGACTG

ACTGTCTGAGACAGAGAGTGTGACAGTCAG

The tags are made in an oligonucleotide synthesizer (a machine that sticks the units together) and then incorporated into virus backbones, just as we described for immunotherapy. The viruses (+ barcodes) then infect cells in culture, these are treated with a drug and the survivors present after a few weeks have their barcode DNAs sequenced. The deal here is that the number of different barcodes detected reflects the proportion of the original cell population that survived – and it indeed turned out that it’s very rare, pre-existing clones that are drug resistant. For one of the cell lines (derived from a human lung cancer) about one in 2,000 of the starting cell population showed resistance to the drug erlotinib.

Why?

The obvious question then is ‘What’s special about those few cells that they can thumb their noses at drugs that kill off most of their pals?’ To begin to get answers Bhang, Michor and colleagues noted that, for the lung cancer line, resistance to erlotinib occurs in cells that have multiple copies of a gene called MET – which makes a signalling protein. Exposing the cells to erlotinib and a MET inhibitor (crizotinib) greatly reduced the size of the resistant population (to one in 200,000).

This still leaves the question of the genetic alterations in that 0.0005% – and of course, finding drugs to target them. A further point is that this was a study of cells grown in the lab and it’s not possible to use this system in patients – but it could be used in mice to follow the development of implanted human tumours. If the causes of resistance can be tracked down it would open the way to using combinations of drugs that target both the bulk of tumour cells and the small sub-populations in which resistance lurks. That upshot would bring us to clinicians at the bedside (non-mathematicians!) – but not before running up a big debt to the maths geeks and in this case to a Viennese Dad who really did know best (offspring of the world please note!).

References

Bhang, H.C. et al. (2015). Studying clonal dynamics in response to cancer therapy using high-complexity barcoding. Nature Medicine 21, 440-448.