Mushrooming Secret Army

 

We have in these pages talked quite a bit about our ‘secret army’ — the bugs that share our body to the extent that bacteria outnumber us on a cell-to-cell basis by at least three to one. As we noted in Secret Army: More Manoeuvres Revealed, bacteria are just one part of what is collectively called the microbiota’ but with over 2000 different species and a total gene pool hundreds of times bigger than our own 20,000 or so, they are by far the biggest. And it’s gradually become clear that they are not with us just because our bodies are warm, damp and comfortable but they help us get the most out of our food and they’re important in the working of our immune system.

Bacteria and cancer

Most critically, in the present context, we now know that shifts in proportions of species in the microbiome can influence cancer development and perhaps even the spread of tumour cells around the body.

Small fry

Important though they are, bacteria aren’t the only members of the microbiome — which includes fungi, viruses and various single-celled parasites (protozoa). Today’s story is about fungi, a group of microorganisms familiar to gardeners world-wide, that includes yeasts and molds, as well as the more familiar mushrooms. There’s estimated to be several million species of fungi, although only about 120,000 have been described. Some we can eat, some can kill us and, of course, there’s magic mushrooms.

With all this diversity you might wonder whether any fungi have elbowed their way into us to share the delights of the human body alongside bacterial microbes. Of course they have: most people will have heard of candidiasis — a fungal infection caused by Candida yeasts that belong to the genus Candida. Candida normally finds its niche in places like the mouth (giving the condition called thrush), gut, vagina and on the skin and usually doesn’t give us any trouble. But, truth to tell, we’ve known very little about fungi in us until recently when the power of DNA sequencing has started to be applied to the topic. This has confirmed that we do carry lots of fungi around with us, albeit that they are only a tiny fraction of the microbial community (somewhat less than 0.1%).

New actor in the cancer cast

This fungal force of microbes is known as the mycobiome (as distinct from the microbiome) and, in contrast to bacteria, there is no evidence that it has a role in cancer. Until, that is, the recent publication from New York University School of Medicine by Berk Aykut, George Miller and friends showing that fungi travel from the gut to the pancreas where a particular species can actually give cancer a helping hand. The cancer in question is pancreatic ductal adenocarcinoma (PDA) that has a particularly dismal prognosis.How a fungus can drive cancer. The scheme represents a tumour in the pancreas changing the make up of the adjacent fungal community and how a protein in the blood called mannose binding lectin (MBL) can attach to the outer surface of a fungal cell. When this happens MBL changes shape so it can then stick to another protein (C3) which in turn activates a relay of proteins called the complement cascade. One upshot of this can be to promote tumour growth. From Dambuza and Brown 2019.

How did they do it?

Aykut et al. first used DNA sequencing to look for fungus-specific sequences in the pancreas of humans with PDA and in mouse models of PDA, They’d previously shown that the bacterial load goes up by about 1000-fold in tumours compared with healthy tissue and, lo and behold, they found a similar increase in fungi. Next they tagged strains of fungus with a fluorescent label and showed that the cells could migrate from the gut to the pancreas of mice in under 30 minutes.

They then tracked down a protein called mannose binding lectin (MBL) expression of which is associated with poor survival in human PDA patients. MBL is a ‘serum protein’, meaning that it floats around in blood. This led to the discovery that MBL can bind to the surface of fungal cells and when it does so changes shape to permit activation of a relay of signal proteins called the complement system. This ‘complement cascade’ is part of our immune system, enhancing the capacity of antibodies and phagocytic cells to clear microbes from the circulation.

Jules Bordet was the chap who first showed that something in normal blood plasma could help to kill off bacteria back at the end of the 19th century and, as such, deserves to be better remembered as a famous Belgian.

The complement system is pretty amazing because, whilst it can trigger an immune response against invading pathogens, it can also switch on inflammatory pathways that help cells grow and move around — in other words, give a helping hand to tumours.

Fungible?

I met this word for the first time a few days ago, courtesy of the journalist and author Ann Treneman. You’d think that no piece on fungi would be complete without it but it turns out to have nothing to do with mushrooms: it just means interchangeable or switchable. But hang on! We can squeeze it in by asking a very relevant question: are pancreatic fungi fungible in terms of their capacity to promote cancer? Aykut et al. did just that and the answer was ‘no they’re not.’ One species seems to be particularly abundant in PDA: the genus Malassezia. This was true for both mouse and human tumours and perhaps that shouldn’t surprise us as Malassezia is the most abundant fungal species in mammalian skin, accounting for more than 80% of our skin mycobiome. So it’s Malassezia not other species (e.g., Candida) that has the power to drive cancer.

Spores of the yeast Malassezia

Fungal footnote

In a final exciting experiment Aykut et al. showed that antifungal drugs halted PDA progression in mice and improved the ability of chemotherapy to shrink the tumour. This obviously raises the notion that if we can find ways of shifting the balance of fungal communities or interfering with the link to the complement cascade we might have a completely new line on desperately needed therapies for this disease.

References

Aykut, B. et al., (2019). The fungal mycobiome promotes pancreatic oncogenesis via activation of MBL. Nature 574, 264–267.

Dambuza, I.M. and Brown, G.D. (2019). Fungi accelerate pancreatic cancer. Nature 574, 184-185.

A Word From The Nerds

I went (a long time ago it has to be admitted) to what people call an ‘old-fashioned’ grammar school. It wasn’t really old-fashioned – we didn’t wear wigs and frock coats – it just put great emphasis in getting its kids into good universities. To this end we were, at an early stage, split into scientists and the rest (aka arts students). It was a bit more severe even than that because the ‘scientists’ were sub-divided: those considered bright did Maths, Chemistry and Physics whilst the rest did Biology instead of Maths (or anything instead of Maths). All of which was consistent with the view that biologists – and that includes medics – could get by without being able to add up. That was a long time ago, of course, but to some extent the myth lives on. In tutorials with first year medical students I found an ace way of inducing nervous breakdowns was to ask them to do a sum in their heads (“Put that calculator away Biggs minor”).

But times do change and when I asked a doctor the other day which branches of medical science required maths, he paused for moment and then said “All of them.” By that he meant that pretty well every area of current research relies on the application of mathematics. We hear much about DNA sequencing, genomics and its various offshoots but all of these need ‘bioinformaticists’ (whizzos at sums) to extract the useful grains form the vast mass of data generated. Much the same may be said of research in what are called imaging techniques – developing methods of detecting tumours – and there is now a vast subject in itself of ‘systems biology’ in which mathematical modeling is applied to complex biological events (e.g., signalling within cells) with the aim of being able to reconstruct what goes on – what folk like to call a holistic approach. A variation on this theme is studying how large populations of cells behave – for example, tumour cells when exposed to an anti-cancer drug. And that’s an important matter: if your drug kills off every cancer cell bar one but that one happens to be very good at reproducing itself, before long you’ll be back to square one. The way to avoid going round in circles is to detect and interrogate individual survivor cells to find out why they are such good escape artists.

Girls will be girls

All of which brings us to Franziska Michor. Born in Vienna of a michor2-d5f528c0eec02b1797c3028e48c17598.pngmathematician father who, she has recounted, told her and her sister that they had either to study maths or marry a mathematician. Sounds a frightening version of tradition to me – and it had perhaps the intended effect on the girls: frantic sprints to the nearest Department of Mathematics. That’s a bit unfair. As they say, some of my best friends are mathematicians – so they’re not at all the stereotypical distrait, inarticulate, socially inept weirdos. Although most of them are.

But Fräulein Michor was clearly one of the exceptions. She’s now a professor at the Dana-Farber Cancer Institute and Harvard School of Public Health in Boston and, with colleagues, she’s had a go at an important question: when cancer cells become resistant to a drug, is it because they acquire new mutations in their DNA or is it that some cells are already resistant and they are the ones that survive and grow. Their results suggest the simple answer is ‘the latter’ – resistant clones are present before treatment and they’re the survivors. So the upshot is clear but the route to it was very clever – not least because the maths involved in teasing out the answer is positively frightening. Fortunately (medics breathe a sigh of relief!) we can ignore the horrors of ‘Stochastic mathematical modeling using a nonhomogeneous continuous-time multitype birth–death process’ – yes, really – and just look at the biology, which was ingenious enough. To get at the answer they developed a tagging system that tracked the individual fates of over one million barcoded cancer cells under drug treatment.

Nerd picBarcoding cells. Strings of DNA 30 base pairs in length and of random sequence are artificially synthesized (coloured bars). These fragments are inserted in the genomes of viruses. The viruses infect cancer cells in culture and, after drug treatment, cells that survive (drug resistant) are harvested, their DNA is extracted and barcode DNA is detected (redrawn from Bhang et al. 2015).

Check this out!

Barcodes were pioneered by two young Americans, Bernard Silver and Norman Woodland, for automatically reading product information at checkouts and nowadays they’re used to mark everything from bananas to railway wagons and plane tickets. Their most familiar form is essentially a one-dimensional array that Woodland said he came up with by drawing Morse code in sand and just extending the dots and dashes to make narrow and wide lines.

120px-UPC-A-036000291452128px-PhotoTAN_mit_Orientierungsmarkierungen.svgbarcode n

 

 

 

 

Cellular barcoding uses the same idea but the ‘label’ is an artificial DNA sequence. Such is the power of the genetic code that a random string made up of 30 of its four distinct units (A, C, G & T) can essentially make an infinite number of different tags. Just like those on supermarket labels, two different codes look the same at first glance:

ACTCTGTGTCTCAGTGTGAGTGTCTGACTG

ACTGTCTGAGACAGAGAGTGTGACAGTCAG

The tags are made in an oligonucleotide synthesizer (a machine that sticks the units together) and then incorporated into virus backbones, just as we described for immunotherapy. The viruses (+ barcodes) then infect cells in culture, these are treated with a drug and the survivors present after a few weeks have their barcode DNAs sequenced. The deal here is that the number of different barcodes detected reflects the proportion of the original cell population that survived – and it indeed turned out that it’s very rare, pre-existing clones that are drug resistant. For one of the cell lines (derived from a human lung cancer) about one in 2,000 of the starting cell population showed resistance to the drug erlotinib.

Why?

The obvious question then is ‘What’s special about those few cells that they can thumb their noses at drugs that kill off most of their pals?’ To begin to get answers Bhang, Michor and colleagues noted that, for the lung cancer line, resistance to erlotinib occurs in cells that have multiple copies of a gene called MET – which makes a signalling protein. Exposing the cells to erlotinib and a MET inhibitor (crizotinib) greatly reduced the size of the resistant population (to one in 200,000).

This still leaves the question of the genetic alterations in that 0.0005% – and of course, finding drugs to target them. A further point is that this was a study of cells grown in the lab and it’s not possible to use this system in patients – but it could be used in mice to follow the development of implanted human tumours. If the causes of resistance can be tracked down it would open the way to using combinations of drugs that target both the bulk of tumour cells and the small sub-populations in which resistance lurks. That upshot would bring us to clinicians at the bedside (non-mathematicians!) – but not before running up a big debt to the maths geeks and in this case to a Viennese Dad who really did know best (offspring of the world please note!).

References

Bhang, H.C. et al. (2015). Studying clonal dynamics in response to cancer therapy using high-complexity barcoding. Nature Medicine 21, 440-448.

Not another ‘Great Cancer Breakthrough’!!!

Since I started writing Betrayed by Nature and this accompanying blog, my take on science reporting in the ‘media’ has undergone considerable change. I guess most of it used to wash over me: now I feel obliged to read it, with a view to making sense of it from the point of view of non-scientists. The dramatic headlines generally fall into two groups – one telling us what not to do/eat, the other revealing how wonderful scientists are.

I admitted recently (Whose side are you on?) that as far as the eating, drinking and exercising injunctions go, I’m beginning to side with those who just wish ‘they’d’ keep quite and let us get on doing whatever we want to do. The other group is trickier because there’s almost always some interesting stuff beneath the press rhetoric. The latest Scientists hail revolutionary breast cancer breakthrough is a case in point. The media coverage refers to a paper just published in Nature that has applied the formidable power of nucleic acid sequencing methods to a large number of breast tumours. The sheer amount of information generated is almost stupefying and the efforts of folk – called ‘bioinformaticists’ – who make sense of the raw data are remarkable.

But the overall message is relatively simple. Like every other tumour, each breast cancer is different at the level of the molecular changes it carries. However, the DNA sequences of genes and the extent to which they are ‘switched on’ to make RNA and protein (‘gene expression’) permit these tumours to be sub-divided into 10 major categories.

So is this a ‘Great Cancer Breakthrough’. Not really. It’s a terrific piece of science but it’s just one more small step towards better designed therapies that’s come from using the wonderful methods that have become available over the last ten years or so.

Did the guys who did the work use the hyped-up language of Mr. Connor in The Independent? Not exactly. This paper is a stunning technical tour-de-force – but the authors merely sign off with the comment that their work ‘reveals novel subgroups that should be the target of future investigation’.

Reference

Curtis, C., Shah, S.P., Chin, S.-F., Turashvili, G., Rueda, O.M. et al. (2012). The genomic and transcriptomic architecture of 2,000 breast tumours reveals novel subgroups. Nature (2012) doi:10.1038/nature10983