A Word From The Nerds

I went (a long time ago it has to be admitted) to what people call an ‘old-fashioned’ grammar school. It wasn’t really old-fashioned – we didn’t wear wigs and frock coats – it just put great emphasis in getting its kids into good universities. To this end we were, at an early stage, split into scientists and the rest (aka arts students). It was a bit more severe even than that because the ‘scientists’ were sub-divided: those considered bright did Maths, Chemistry and Physics whilst the rest did Biology instead of Maths (or anything instead of Maths). All of which was consistent with the view that biologists – and that includes medics – could get by without being able to add up. That was a long time ago, of course, but to some extent the myth lives on. In tutorials with first year medical students I found an ace way of inducing nervous breakdowns was to ask them to do a sum in their heads (“Put that calculator away Biggs minor”).

But times do change and when I asked a doctor the other day which branches of medical science required maths, he paused for moment and then said “All of them.” By that he meant that pretty well every area of current research relies on the application of mathematics. We hear much about DNA sequencing, genomics and its various offshoots but all of these need ‘bioinformaticists’ (whizzos at sums) to extract the useful grains form the vast mass of data generated. Much the same may be said of research in what are called imaging techniques – developing methods of detecting tumours – and there is now a vast subject in itself of ‘systems biology’ in which mathematical modeling is applied to complex biological events (e.g., signalling within cells) with the aim of being able to reconstruct what goes on – what folk like to call a holistic approach. A variation on this theme is studying how large populations of cells behave – for example, tumour cells when exposed to an anti-cancer drug. And that’s an important matter: if your drug kills off every cancer cell bar one but that one happens to be very good at reproducing itself, before long you’ll be back to square one. The way to avoid going round in circles is to detect and interrogate individual survivor cells to find out why they are such good escape artists.

Girls will be girls

All of which brings us to Franziska Michor. Born in Vienna of a michor2-d5f528c0eec02b1797c3028e48c17598.pngmathematician father who, she has recounted, told her and her sister that they had either to study maths or marry a mathematician. Sounds a frightening version of tradition to me – and it had perhaps the intended effect on the girls: frantic sprints to the nearest Department of Mathematics. That’s a bit unfair. As they say, some of my best friends are mathematicians – so they’re not at all the stereotypical distrait, inarticulate, socially inept weirdos. Although most of them are.

But Fräulein Michor was clearly one of the exceptions. She’s now a professor at the Dana-Farber Cancer Institute and Harvard School of Public Health in Boston and, with colleagues, she’s had a go at an important question: when cancer cells become resistant to a drug, is it because they acquire new mutations in their DNA or is it that some cells are already resistant and they are the ones that survive and grow. Their results suggest the simple answer is ‘the latter’ – resistant clones are present before treatment and they’re the survivors. So the upshot is clear but the route to it was very clever – not least because the maths involved in teasing out the answer is positively frightening. Fortunately (medics breathe a sigh of relief!) we can ignore the horrors of ‘Stochastic mathematical modeling using a nonhomogeneous continuous-time multitype birth–death process’ – yes, really – and just look at the biology, which was ingenious enough. To get at the answer they developed a tagging system that tracked the individual fates of over one million barcoded cancer cells under drug treatment.

Nerd picBarcoding cells. Strings of DNA 30 base pairs in length and of random sequence are artificially synthesized (coloured bars). These fragments are inserted in the genomes of viruses. The viruses infect cancer cells in culture and, after drug treatment, cells that survive (drug resistant) are harvested, their DNA is extracted and barcode DNA is detected (redrawn from Bhang et al. 2015).

Check this out!

Barcodes were pioneered by two young Americans, Bernard Silver and Norman Woodland, for automatically reading product information at checkouts and nowadays they’re used to mark everything from bananas to railway wagons and plane tickets. Their most familiar form is essentially a one-dimensional array that Woodland said he came up with by drawing Morse code in sand and just extending the dots and dashes to make narrow and wide lines.

120px-UPC-A-036000291452128px-PhotoTAN_mit_Orientierungsmarkierungen.svgbarcode n

 

 

 

 

Cellular barcoding uses the same idea but the ‘label’ is an artificial DNA sequence. Such is the power of the genetic code that a random string made up of 30 of its four distinct units (A, C, G & T) can essentially make an infinite number of different tags. Just like those on supermarket labels, two different codes look the same at first glance:

ACTCTGTGTCTCAGTGTGAGTGTCTGACTG

ACTGTCTGAGACAGAGAGTGTGACAGTCAG

The tags are made in an oligonucleotide synthesizer (a machine that sticks the units together) and then incorporated into virus backbones, just as we described for immunotherapy. The viruses (+ barcodes) then infect cells in culture, these are treated with a drug and the survivors present after a few weeks have their barcode DNAs sequenced. The deal here is that the number of different barcodes detected reflects the proportion of the original cell population that survived – and it indeed turned out that it’s very rare, pre-existing clones that are drug resistant. For one of the cell lines (derived from a human lung cancer) about one in 2,000 of the starting cell population showed resistance to the drug erlotinib.

Why?

The obvious question then is ‘What’s special about those few cells that they can thumb their noses at drugs that kill off most of their pals?’ To begin to get answers Bhang, Michor and colleagues noted that, for the lung cancer line, resistance to erlotinib occurs in cells that have multiple copies of a gene called MET – which makes a signalling protein. Exposing the cells to erlotinib and a MET inhibitor (crizotinib) greatly reduced the size of the resistant population (to one in 200,000).

This still leaves the question of the genetic alterations in that 0.0005% – and of course, finding drugs to target them. A further point is that this was a study of cells grown in the lab and it’s not possible to use this system in patients – but it could be used in mice to follow the development of implanted human tumours. If the causes of resistance can be tracked down it would open the way to using combinations of drugs that target both the bulk of tumour cells and the small sub-populations in which resistance lurks. That upshot would bring us to clinicians at the bedside (non-mathematicians!) – but not before running up a big debt to the maths geeks and in this case to a Viennese Dad who really did know best (offspring of the world please note!).

References

Bhang, H.C. et al. (2015). Studying clonal dynamics in response to cancer therapy using high-complexity barcoding. Nature Medicine 21, 440-448.

Advertisements

The Hay Festival

According to the Hay Festival  a recording of my talk ‘Demystifying Cancer’ on Wednesday 28th May should be available on their web site shortly and it can also be heard on the university site. However, I thought it might be helpful to post a version, not least for the for the rather breathless lady who arrived at the book signing session apologising for missing the lecture because she’d got stuck in mud. So for her and perhaps for many others I had the privilege of chatting to afterwards, read on …

 The Amazing World of Cells, Molecules … and CancerOpening pic

One of the biggest influences on my early years was the composer and conductor Antony Hopkins, who died a few days ago. Most of what I knew about music by the time I was 15 came from his wonderfully clear dissections of compositions in the series Talking About Music broadcast by the BBC Third Programme. When he was axed by the Beeb in 1992 for being ‘too elitist’ – yes, they talked that sort of drivel even then – Hopkins might have wished he’d been a biologist. After all, biology must be the easiest subject in the world to talk about. Your audience is hooked from the outset because they know it’s about them – if not directly then because all living things on the planet are interlinked – so even the BBC would struggle to make an ‘elitism’ charge stick. They know too that it’s beautiful, astonishing and often funny – both from what they see around them and also, of course, courtesy of David Attenborough. So it’s not a surprise when you show them that the micro-world of cells and molecules is every bit as wonderful.

The secret of life

What does come as a bit of a shock to most non-scientists is when you explain the secret of life. No, that’s not handing round pots of an immortalization elixir – much better, it’s outlining what’s sometimes rather ponderously called the central dogma of molecular biology – the fact that our genetic material (aka DNA) is made from only four basic units (most easily remembered by their initials: A, C, G and T – humans have over three thousand million of these stuck together). This is our ‘genome’ and the ‘genetic code’ enshrined in the DNA sequence makes us what we are – with small variations giving rise to the differences between individuals. The genetic code carries instructions for glueing together another set of small chemicals to make proteins. There are 20 of these (amino acids) and they can be assembled in any order to make proteins that can be thousands or even tens of thousands of amino acids long. These assemblies fold up into 3D shapes that give them specific activities. Proteins make living things what they are – they’re ‘the machines of life’ – and their infinite variety is responsible for all the different species to have appeared on earth. Can the basis of life really be so simple?

The paradox of cancer

Turning to cancer, a three word definition of ‘cells behaving badly’ would do fine. A more scientific version would be ‘cells proliferating abnormally.’ That is, cells reproducing either when they shouldn’t, or more rapidly than normal, or doing so in the wrong place. The cause of this unfriendly behavior is damaged DNA, that is, alteration in the genetic code – any such change being a ‘mutation’. If a mutation affects a protein so that it becomes, say, hyperactive at making cells proliferate (i.e. dividing to make more cells), you have a potential cancer ‘driver’. So at heart cancer’s very simple: it’s driven by mutations in DNA that affect proteins controlling proliferation. That’s true even of the 20% or so of cancers caused by chronic infection – because that provokes inflammation, which in turn leads to DNA damage.

The complexity of cancer arises because, in contrast to several thousand other genetic diseases in which just a single gene is abnormal (e.g., cystic fibrosis), tumour cells accumulate lots of mutations. Within this genetic mayhem, relatively small groups of potent mutations (half a dozen or so) emerge that do the ‘driving’. Though only a few ‘driver mutations’ are required, an almost limitless number of combinations can arise.

Accumulating mutations takes time, which is why cancers are predominantly diseases of old age. Even so, we should be aware that life is a game of genetic roulette in which each individual has to deal with the dice thrown by their parents. The genetic cards we’re dealt at birth may combine with mutations that we pick up all the time (due to radiation from the sun and the ground, from some foods and as a result of chemical reactions going on inside us) to cause cancers and, albeit rarely, in unlucky individuals these can arise at an early age. However, aside from what Mother Nature endows, humans are prone to giving things a helping hand through self-destructive life-style choices – the major culprits, of course, being tobacco, alcohol and poor diets, the latter being linked to becoming overweight and obese. Despite these appalling habits we’re living longer (twice as long as at the beginning of the twentieth century) which means that cancer incidence will inevitably rise as we have more time to pick up the necessary mutations. Nevertheless, if we could ban cigarettes, drastically reduce alcohol consumption and eat sensibly we could reduce the incidence of cancers by well over a half.

How are we doing?

Some readers may recall that forty-odd years ago in 1971 President Nixon famously committed the intellectual and technological might of the USA to a ‘War on Cancer’ saying, in effect, let’s give the boffins pots of money to sort it out pronto. Amazing discoveries and improved treatments have emerged in the wake of that dramatic challenge (not all from Uncle Sam, by the way!) but, had we used the first grant money to make a time machine from which we were able to report back that in 2013 nearly six hundred thousand Americans died from cancer, that the global death toll was over eight million people a year and will rise to more than 13 million by 2030 (according to the Union for International Cancer Control), rather less cash might subsequently have been doled out. Don’t get me wrong: Tricky Dicky was spot on to do what he did and scientists are wonderful – clever, dedicated, incredibly hard-working, totally uninterested in personal gain and almost always handsome and charming. But the point here is that, well, sometimes scientific questions are a little bit more difficult than they look.

Notwithstanding, there have been fantastic advances. The five year survival rates for breast and prostate cancers have gone from below 50% to around 90% – improvements to which many factors have contributed including greater public awareness (increasing the take-up of screening services), improved surgical and radiology methods and, of course, new drugs. But for all the inspiration, perspiration and fiscal lubrication, cancer still kills over one third of all people in what we like to refer to as the “developed” world, globally breast cancer killed over half a million in 2012 and for many types of cancer almost no impact has been made on the survival figures. In the light of that rather gloomy summary we might ask whether there is any light at the end of the tunnel.

The Greatest Revolution

From one perspective it’s surprising we’ve made much progress at all because until just a few years ago we had little idea about the molecular events that drive cancers and most of the advances in drug treatment have come about empirically, as the scientists say – in plain language by trial and error. But in 2003 there occurred one of the great moments in science – arguably the most influential event in the entire history of medical science – the unveiling of the first complete DNA sequence of a human genome. This was the product of a miraculous feat of international collaboration called The Human Genome Project that determined the order of the four units (A, C, G and T) that make up human DNA (i.e. the sequence). Set up in 1990, the project was completed by 2003, two years ahead of schedule and under budget.

If the human genome project was one of the most sensational triumphs in the history of science what has happened in the ensuing 10 years is perhaps even more dazzling. Quite breathtaking technical advances now mean that DNA can be sequenced on a truly industrial scale and it is possible to obtain the complete sequence of a human genome in a day or so at a cost of about $1,000.

These developments represent the greatest revolution because they are already having an impact on every facet of biological science: food production, microbiology and pesticides, biofuels – and medicine. But no field has been more dramatically affected by this technological broadside than cancer and already thousands of genomes have been sequenced from a wide range of tumours. The most striking result has been to reveal the full detail of the astonishing genetic mayhem that characterizes cancer cells. Tens of thousands or even hundreds of thousands of mutations featuring every kind of molecular gymnastics imaginable occur in a typical tumour cell, creating a landscape of stunning complexity. At first sight this makes the therapeutic challenge seem daunting, but all may not be lost because the vast majority of this genetic damage plays no role in cancer development (they’re ‘passenger’ mutations) and the power of sequencing now means they can be sifted from the much smaller hand of ‘driver’ mutations. From this distillation have emerged sets of ‘mutational signatures’ for most of the major types of cancers. This is a seismic shift from the traditional method of assessing tumours – looking directly at the cells after treating them with markers to highlight particular features – and this genetic approach, providing for the first time a rigorous molecular basis for classifying tumours, is already affecting clinical practice through its prognostic potential and informing decisions about treatment.

A new era

One of the first applications of genomics to cancer, was undertaken by a group at The Wellcome Trust Sanger Institute near Cambridge (where the UK part of the Human Genome Project had been carried out), who screened samples of the skin cancer known as malignant melanoma. This is now the fifth most common UK cancer – in young people (aged 15 to 34) it’s the second most common – and it killed over 2,200 in 2012. Remarkably, about half the tumours were found to have a hyperactivating mutation in a gene called BRAF, the effect being to switch on a signal pathway so that it drives cell proliferation continuously. It was a remarkable finding because up until then virtually nothing was known about the molecular biology of this cancer. Even more amazingly, within a few years it had lead to the development of drugs that caused substantial regression of melanomas that had spread to secondary sites (metastasized).

This was an early example of what has become known as personalized medicine – the concept that molecular analysis will permit treatment regimens to be tailored to the stage of development of an individual’s cancer. And maybe, at some distant time, the era of personalized medicine will truly come about. At the moment, however, we have very few drugs that are specific for cancer cells – and even when drugs work initially, patients almost invariably relapse as tumours become resistant and the cancer returns – one of the major challenges for cancer biology.

It behoves us therefore to think laterally, of impersonal medicine if you like, and one alternative approach to trying to hit the almost limitless range of targets revealed by genomics is to ask: do tumour cells have a molecular jugular – a master regulator through which all the signals telling it to proliferate have to pass. There’s an obvious candidate – a protein called MYC that is essential for cells to proliferate. The problem with stopping MYC working is that humans make about one million new cells a second, just to maintain the status quo – so informed opinion says that blocking MYC will kill so many cells the animal will die – which would certainly fix cancer but not quite in the way we’re aiming for. Astoundingly, it turns out in mice at least it doesn’t work like that. Normal cells tolerate attenuation of MYC activity pretty well but the tumour cells die. What a result!! We should, of course, bear in mind that the highway of cancer therapy is littered with successful mouse treatments that simply didn’t work in us – but maybe this time we’ll get lucky.

An Achilles’ heel?

In defining cancers we noted the possibility that tumour cells might proliferate in the wrong place. So important is this capacity that most cancer patients die as a result of tumour cells spreading around the body and founding secondary colonies at new sites – a phenomenon called metastasis. Well over 100 years ago a clever London physician by the name of Stephen Paget drew a parallel between the growth of tumours and plants: ‘When a plant goes to seed, its seeds are carried in all directions; but they can only live and grow if they fall on congenial soil.’ From this emerged the “seed and soil” theory as at least a step to explaining metastasis. Thus have things languished until very recent findings have begun to lift the metastatic veil. Quite unexpectedly, in mouse models, primary tumours dispatch chemical messengers into the blood stream long before any of their cells set sail. These protein news-bearers essentially tag a landing site within the circulatory system on which the tumour cells touch down. Which sites are tagged depends on the type of tumour – consistent with the fact that human cancers show different preferences in metastatic targets.

These revelations have been matched by stunning new video methods that permit tumour cells to be tracked inside live mice. For the first time this has shone a light on the mystery of how tumour cells get into the circulation – the first step in metastasis. Astonishingly tumour cells attach themselves to a type of normal cell, macrophages, whose usual job is to engulf and digest cellular debris and bugs. The upshot of this embrace is that the macrophages cause the cells that line blood vessels to lose contact with each other, creating gaps in the vessel wall through which tumour cells squeeze to make their escape. This extraordinary hijacking has prognostic value and is being used to develop a test for the risk of metastasis in breast cancers.

The very fact that cancers manifest their most devastating effects by spreading to other sites may lay bare an Achilles’ heel. Other remarkable technical developments mean that it’s now possible to fish out cancer cells (or DNA they’ve released) from a teaspoonful of circulating blood (that’s a pretty neat trick in itself, given we’re talking about fewer than 100 tumour cells in a sea of several billion cells for every cubic millimeter of blood). Coupling this to genome sequencing has already permitted the response of patients to drug therapy to be monitored but an even more exciting prospect is that through these methods we may be moving towards cancer detection perhaps years earlier than is possible by current techniques.

As we’ve seen, practically every aspect of cancer biology is now dominated by genomics. Last picIt’s so trendy that anyone can join in. Songs have been written about DNA and you can even make a musical of your own genetic code, French physicist Joel Sternheimer having come up with a new genre – protein music – in which sequence information is converted to musical notes. Antony Hopkins, ever receptive to new ideas, would have been enthralled and, with characteristic enthusiasm, been only too happy to devote an episode of Talking About Music to making tunes from nature.