Dennis’s Pet Menace

As it happened, I’d already agreed to appear on Jeremy Sallis’ Lunchtime Live Show on BBC Radio Cambridgeshire – the plan being just to chat about cancery topics that might be of interest to listeners. Which would have been fine – if only The World Health Organization had left us in peace. But of course they chose last Tuesday to publish their lengthy cogitations on the subject of whether meat is bad for us – i.e. causes cancer.

Cue Press extremism: prime example The Times, quite predictably – they really aren’t great on biomedical science – who chucked kerosene on the barbie with the headline ‘Processed meats blamed for thousands of cancer deaths a year’.

But – to precise facts – and strictly it’s The International Agency for Research on Cancer, the cancer agency of the World Health Organization (WHO), that has ‘evaluated the carcinogenicity of the consumption of red meat and processed meat.’

But hang on … haven’t we been here before?

Indeed we have. As long ago as January 2012 in these pages we commented on the evidence that processed meat can cause pancreatic cancer and in May of the same year we reviewed the cogitations of the Harvard School of Public Health’s 28 year study of 120,000 people that concluded eating red meat contributes to cardiovascular disease, cancer and diabetes. To be fair, that history partially reflects why the WHO Working Group of 22 experts from 10 countries have taken so long to go public: they reviewed no fewer than 800 epidemiological studies! However, as the most frequent target for study was colorectal (bowel) cancer, that was the focus of their report released on 26th October 2015.

So what are we talking about?

Red meat, which means any unprocessed mammalian muscle meat, e.g., beef, veal, pork, lamb, mutton, horse or goat meat, that we usually cook before eating.

Processed meat: any meat not eaten fresh that has been salted, cured, smoked or whatever and commonly treated with chemicals to enhance flavour and colour and to prevent the growth of bacteria.

What did they say?

Processed meat is now classified as carcinogenic to humans – that is it goes into the top group (Group 1) of agents that cause cancer.

Red meat is probably carcinogenic to humans (Group 2A). Group 2B is for things that are possibly carcinogenic to humans.

Why?

Because 12 of the 18 studies they reviewed showed a link between consumption of processed meat and bowel cancer and because it’s known that agents commonly added to processed meat (nitrates and nitrites) can, when we eat them, turn into chemicals that can directly damage DNA, i.e. cause mutations and hence promote cancers.

For red meat 7 out of 15 studies showed positive associations of high versus low consumption with bowel cancer and there is strong mechanistic evidence for a carcinogenic effect i.e. when meat is cooked genotoxic (i.e. DNA-damaging) chemicals can be generated. They put red meat in the probably group because several of the studies that the Working Group couldn’t fault – and therefore couldn’t leave out – showed no association.

Stop woffling

My laptop likes to turn ‘woffling’ into ‘wolfing’. Maybe it’s trying to tell me something.

But is The WHO trying to tell us something specific about wolfing? To be fair, they have a go by estimating that every 50 gram portion of processed meat (say a couple of slices of bacon) eaten daily increases the risk of bowel cancer by about 18%. For red meat the data ‘suggest’ that the risk of bowel cancer could increase by 17% for every 100 gram portion eaten daily.

And what might that mean?

In the UK about 6 people in 100 get bowel cancer: if you take The WHO maximum estimate and have everyone eat 50 grams of processed meat every day of their lives such that 18% more of them would get bowel cancer, the upshot would be 7 people in 100 rather than 6. So it’s a small rise in a relatively small risk.

As the report points out, the Global Burden of Disease Project reckons diets high in processed meat cause about 34,000 cancer deaths per year worldwide and, if the reported associations hold up, the figure for red meat would be 50,000. Compare those figures with smoking that increases the risk of lung cancer by 20-fold and The WHO’s estimate of up to 6 million cancer deaths per year globally caused by tobacco use and 600,000 per year by alcohol consumption.

All of which suggests that it isn’t very helpful to lump meat eating, tobacco and asbestos in the same cancer-causing category and that The WHO could do worse than come up with a new classification system.

And the message?

Unchanged. Remember mankind evolved into the most successful species on the planet as a meat eater. As the advert used to say: It looks good, it tastes good and by golly it does you good – not least as a source of protein, vitamins and other nutrients. Do some exercise and eat a balanced diet – just in case you’ve forgotten, that means limit the amount of red meat (The WHO suggests no more than 30 grams a day for men, 25 g for women) so try fish, poultry, etc. Stick with the ‘good carbs’ (vegetables, fruits, whole grains, etc.), cut out the ‘bad’ (sugar – see Biting the Bitter Bullet), eat fishy fats not saturated fats and, to end on a technical note, don’t pig out.

_65259128_6136791400_49fc5aaece_b

‘The Divine Swine’ Castelnuovo Rangone, Italy

Meanwhile back on the Beeb

When the meat story broke I was a bit concerned that we might end up spending the whole of Lunchtime Live on how many bangers are lethal – especially as we were taking calls from listeners. Just in case things became a bit myopic I had Rasher up my sleeve. Rasher, you may recall, was Dennis the Menace‘s pet pig (in the The Beano‘s comic strip) who had a brother (Hamlet), a sister (Virginia Ham) and various other porky rellos. To bring it up to date we’d have introduced Sam Salami and Frank Furter and, of course, Rasher’s grandfather who was the model for the bronze statue named ‘The Divine Swine’ to be found in the little town of Castelnuovo Rangone in Pig Valley, Italy, the home of Parma ham.

But I shouldn’t have worried. All was well in the hands of Jeremy Sallis who, being a brilliant host, ensured that we mainly chatted about meatier matters than what to have for breakfast.

References

Press release: IARC Monographs evaluate consumption of red meat and processed meat.

Q&A on the carcinogenicity of the consumption of red meat and processed meat.

Carcinogenicity of consumption of red and processed meat. www.thelancet.com/oncology Published online October 26, 2015

Advertisements

A Word From The Nerds

I went (a long time ago it has to be admitted) to what people call an ‘old-fashioned’ grammar school. It wasn’t really old-fashioned – we didn’t wear wigs and frock coats – it just put great emphasis in getting its kids into good universities. To this end we were, at an early stage, split into scientists and the rest (aka arts students). It was a bit more severe even than that because the ‘scientists’ were sub-divided: those considered bright did Maths, Chemistry and Physics whilst the rest did Biology instead of Maths (or anything instead of Maths). All of which was consistent with the view that biologists – and that includes medics – could get by without being able to add up. That was a long time ago, of course, but to some extent the myth lives on. In tutorials with first year medical students I found an ace way of inducing nervous breakdowns was to ask them to do a sum in their heads (“Put that calculator away Biggs minor”).

But times do change and when I asked a doctor the other day which branches of medical science required maths, he paused for moment and then said “All of them.” By that he meant that pretty well every area of current research relies on the application of mathematics. We hear much about DNA sequencing, genomics and its various offshoots but all of these need ‘bioinformaticists’ (whizzos at sums) to extract the useful grains form the vast mass of data generated. Much the same may be said of research in what are called imaging techniques – developing methods of detecting tumours – and there is now a vast subject in itself of ‘systems biology’ in which mathematical modeling is applied to complex biological events (e.g., signalling within cells) with the aim of being able to reconstruct what goes on – what folk like to call a holistic approach. A variation on this theme is studying how large populations of cells behave – for example, tumour cells when exposed to an anti-cancer drug. And that’s an important matter: if your drug kills off every cancer cell bar one but that one happens to be very good at reproducing itself, before long you’ll be back to square one. The way to avoid going round in circles is to detect and interrogate individual survivor cells to find out why they are such good escape artists.

Girls will be girls

All of which brings us to Franziska Michor. Born in Vienna of a michor2-d5f528c0eec02b1797c3028e48c17598.pngmathematician father who, she has recounted, told her and her sister that they had either to study maths or marry a mathematician. Sounds a frightening version of tradition to me – and it had perhaps the intended effect on the girls: frantic sprints to the nearest Department of Mathematics. That’s a bit unfair. As they say, some of my best friends are mathematicians – so they’re not at all the stereotypical distrait, inarticulate, socially inept weirdos. Although most of them are.

But Fräulein Michor was clearly one of the exceptions. She’s now a professor at the Dana-Farber Cancer Institute and Harvard School of Public Health in Boston and, with colleagues, she’s had a go at an important question: when cancer cells become resistant to a drug, is it because they acquire new mutations in their DNA or is it that some cells are already resistant and they are the ones that survive and grow. Their results suggest the simple answer is ‘the latter’ – resistant clones are present before treatment and they’re the survivors. So the upshot is clear but the route to it was very clever – not least because the maths involved in teasing out the answer is positively frightening. Fortunately (medics breathe a sigh of relief!) we can ignore the horrors of ‘Stochastic mathematical modeling using a nonhomogeneous continuous-time multitype birth–death process’ – yes, really – and just look at the biology, which was ingenious enough. To get at the answer they developed a tagging system that tracked the individual fates of over one million barcoded cancer cells under drug treatment.

Nerd picBarcoding cells. Strings of DNA 30 base pairs in length and of random sequence are artificially synthesized (coloured bars). These fragments are inserted in the genomes of viruses. The viruses infect cancer cells in culture and, after drug treatment, cells that survive (drug resistant) are harvested, their DNA is extracted and barcode DNA is detected (redrawn from Bhang et al. 2015).

Check this out!

Barcodes were pioneered by two young Americans, Bernard Silver and Norman Woodland, for automatically reading product information at checkouts and nowadays they’re used to mark everything from bananas to railway wagons and plane tickets. Their most familiar form is essentially a one-dimensional array that Woodland said he came up with by drawing Morse code in sand and just extending the dots and dashes to make narrow and wide lines.

120px-UPC-A-036000291452128px-PhotoTAN_mit_Orientierungsmarkierungen.svgbarcode n

 

 

 

 

Cellular barcoding uses the same idea but the ‘label’ is an artificial DNA sequence. Such is the power of the genetic code that a random string made up of 30 of its four distinct units (A, C, G & T) can essentially make an infinite number of different tags. Just like those on supermarket labels, two different codes look the same at first glance:

ACTCTGTGTCTCAGTGTGAGTGTCTGACTG

ACTGTCTGAGACAGAGAGTGTGACAGTCAG

The tags are made in an oligonucleotide synthesizer (a machine that sticks the units together) and then incorporated into virus backbones, just as we described for immunotherapy. The viruses (+ barcodes) then infect cells in culture, these are treated with a drug and the survivors present after a few weeks have their barcode DNAs sequenced. The deal here is that the number of different barcodes detected reflects the proportion of the original cell population that survived – and it indeed turned out that it’s very rare, pre-existing clones that are drug resistant. For one of the cell lines (derived from a human lung cancer) about one in 2,000 of the starting cell population showed resistance to the drug erlotinib.

Why?

The obvious question then is ‘What’s special about those few cells that they can thumb their noses at drugs that kill off most of their pals?’ To begin to get answers Bhang, Michor and colleagues noted that, for the lung cancer line, resistance to erlotinib occurs in cells that have multiple copies of a gene called MET – which makes a signalling protein. Exposing the cells to erlotinib and a MET inhibitor (crizotinib) greatly reduced the size of the resistant population (to one in 200,000).

This still leaves the question of the genetic alterations in that 0.0005% – and of course, finding drugs to target them. A further point is that this was a study of cells grown in the lab and it’s not possible to use this system in patients – but it could be used in mice to follow the development of implanted human tumours. If the causes of resistance can be tracked down it would open the way to using combinations of drugs that target both the bulk of tumour cells and the small sub-populations in which resistance lurks. That upshot would bring us to clinicians at the bedside (non-mathematicians!) – but not before running up a big debt to the maths geeks and in this case to a Viennese Dad who really did know best (offspring of the world please note!).

References

Bhang, H.C. et al. (2015). Studying clonal dynamics in response to cancer therapy using high-complexity barcoding. Nature Medicine 21, 440-448.