Re-writing the Manual of Life

A little while ago we talked about a fantastic triumph by a team at Great Ormond Street Hospital (Gosh! Wonderful GOSH) in using a form of immunotherapy to save a little girl. What they did was to take the T cells from a sample of her blood and use gene editing – molecular cutting and pasting – to remove some genes and add others before growing more of the cells and then putting them back into the patient.

Gene editing – genetic engineering that removes or inserts sections of DNA – uses engineered nucleases, enzymes that snip DNA but do so in a controlled way by homing in on a specific site (i.e. a defined sequence of As, Cs, Gs and Ts).

We mentioned that there are four main ways of doing this kind of engineering – the GOSH group used ‘transcription activator-like effectors’ (TALEs). However, the method that has made the biggest headlines is called CRISPR/Cas, and it has been very much in the news because a legal battle is underway to determine who did what in its development and who, therefore, will be first in line for a Nobel Prize.

Fortunately we can ignore such base pursuits and look instead at where this technology might be taking us.

What is CRISPR/Cas?

CRISPRs (pronounced crispers) are bits of DNA that contain short repetitions of base sequence, each next to a ‘spacer’ sequence. The spacers have accumulated in bacteria as a defence mechanism – they’re part of the bacterial immune system – and they’re identical to sequences found in viruses that infect microbes. In other words, the cunning bugs pick up bits of dangerous viruses to make a rogues gallery so they can recognize and attack those viruses next time they pop in.

Close to CRISPR sit genes encoding Cas proteins (enzymes that cut DNA, so they’re ‘nucleases’). When the CRISPR-spacer DNA is read by the machinery of the cell to make RNA, the spacer regions stick to Cas proteins and the whole complex, including the viral sequences, can roam the cell seeking a virus with genetic material that matches the CRISPR RNA. The CRISPR RNA sticks to the virus and Cas chops its DNA – end of virus. So Cas, by binding to CRISPR RNA, becomes an RNA-guided DNA cutter.

crispr-pic

CRISPR-CAS: Bug defence against invaders. Viruses can attack bacteria just as they can human cells. Over time bugs have evolved a cunning defence strategy: they insert short bits of viral DNA into their own genome (above). These contain repeated sequences of bases and each is followed by short segments of ‘spacer DNA’ (above). This happens next to DNA that encodes Cas proteins so that both are ‘read’ to make RNA (transcription). Cas proteins bind to spacer RNA, leaving the adjacent viral RNA free to attach to any complementary viral DNA it encounters. The Cas enzyme is thus guided to DNA that it can cleave. CRISPR stands for Clustered Regularly Interspaced Short Palindromic Repeats.

Why is CRISPR/Cas in the headlines?

We saw in Gosh! Wonderful GOSH how the Great Ormond Street Hospital team tinkered with DNA and in Self Help – Part 2 we summarized another way of doing this using viruses (notably a disabled form of the human immunodeficiency virus) to carry novel genes into cells.

A further arm of immunotherapy attempts to reverse an effect called checkpoint blockade whereby the immune system response to tumours is damped down – e.g. by using antibodies that target a protein called PD-1 (Self Help – Part 1).

Now comes news of a Chinese trial which will be the first time cells modified using CRISPR–Cas9 gene editing have been injected into people. The chap in charge is Lu You from Sichuan University’s West China Hospital in Chengdu and the plan is to take T cells from the blood patients with metastatic non-small cell lung cancer for whom chemotherapy, radiation therapy and other treatments have failed.

The target will be the PD-1 gene, the idea being that, if you want to stop PD-1 doing its stuff, far better than mucking about with antibodies is to just knock out its gene: no gene no protein! What could possibly go wrong?

Well, wonderful though CRISPR is, it doesn’t always hit the right target but in this trial the cells can be tested to make sure it’s the PD-1 gene that’s been zonked – so that shouldn’t be a problem. However, it’s a blockbuster in that all the multiplied T cells put back into the patient will be active – i.e. will have lost the PD-1 brake. Whilst that may be good for zonking tumours, goodness knows what it might do elsewhere.

The initial trial is on a small scale – just 10 people. If there are problems one possibility is to try to take the T cells from the site of the tumour, which might select those specifically targeting the tumour – not straightforward as lung cancers are difficult to get at.

Anyone for a DNA upgrade?

It’s hard to say where all this is leading. However, as Chinese scientists have already made the first CRISPR-edited human embryos and the first CRISPR-edited monkeys, the only safe bet is that China will be to the fore.

 

Advertisements

The Shocking Effect of Boiled Bugs

There’s never a dull moment in science – well, not many – and at the moment no field is fizzing more than immunotherapy. Just the other day in Outsourcing the Immune Response we talked about the astonishing finding that cells from healthy people could be used to boost the immune response – a variant on the idea of taking from patients cells that attack cancers, growing them in the lab and using genetic engineering to increase potency (generally called adoptive cell therapy).

A general prod

Just when you thought that was as smart as it could get, along comes Angus Dalgleish and chums from various centres in the UK and Spain with yet another way to give the immune system a shock. They used microorganisms (i.e. bugs) as a tweaker. The idea is that bacteria (that have been heat-killed) are injected, they interact with the host’s immune system and, by altering the proteins expressed on immune cells (macrophages, natural killer cells and T cells) can boost the immune response. That in turn can act to kill tumour cells. It’s a general ‘immunomodulatory’ effect. Dalgleish describes it as “rather like depth-charging the immune system which has been sent to sleep”. Well, giving it a prod at least.

bugs-pic

Inactivating bugs (bacteria) and waking up the immune system.

And a promising effect

The Anglo-Spanish effort used IMM-101 (a heat-killed suspension of a bacterium called Mycobacterium obuense) injected under the skin, which has no significant side-effects. The trial was carried out in patients with advanced pancreatic cancer, a disease with dismal prognosis, and IMM-101 immunotherapy was combined with the standard chemotherapy drug (gemcitabine). IMM-101increased survival from a median of 4.4 months to 7 months with some patients living for more than a year and one for nearly three years.

Although the trial numbers are small as yet, this is a very exciting advance because it looks as though immunotherapy may be able to control one of the most serious of cancers in which its incidence nearly matches its mortality.

References

Dalgleish, A. et al. (2016). Randomised, open-label, phase II study of gemcitabine with and without IMM-101 for advanced pancreatic cancer. British Journal of Cancer doi: 10.1038/bjc.2016.271.

 

Outsourcing the Immune Response

We’re very trendy in these pages, for no other reason than that the idea is to keep up to date with exciting events in cancer biology. Accordingly, we have recently talked quite a lot about the emerging field of cancer immunotherapy – the notion that our in-built immune system will try to kill cancer cells as they emerge, because it ‘sees’ them as being to some extent ‘foreign’, but that when tumours make their presence known it has not been able to do the job completely. The idea of immunotherapy is to give our in-house system a helping hand and we’ve seen some of the approaches in Self Help – Part 2 and Gosh! Wonderful GOSH.

The immune see-saw

Our immune system walks a tight-rope: on the one hand it should attack and eliminate any ‘foreign’ cells it sees (so that we aren’t killed by infections) but, on the other, if it’s too efficient it will start destroying out own cells (which is what happens in auto-immune diseases such as Graves disease (overactive thyroid gland) and rheumatoid arthritis.

Like much of our biology, then, it’s a tug-of-war: to kill or to ignore? And, like the cell cycle that determines whether a cell should grow and divide to make two cells, it’s controlled by the balance between ‘accelerators’ and ‘brakes’. The main targets for anti-tumour immune activity are mutated proteins that appear on the surface of cancer cells – called neo-antigens (see The Shape of Things to Come?)

The aim of immunotherapy then is to boost tumour responses by disabling the ‘brakes’. And it’s had some startling successes with patients going into long-term remission. So the basic idea works but there’s a problem: generally immunotherapy doesn’t work and, so far, in only about one in ten of patients have there been significant effects.

Sub-contracting to soup-up detection

Until now it’s seemed that only a very small fraction of expressed neo-antigens (less than 1%) can turn on an immune response in cancer patients. In an exciting new take on this problem, a team of researchers from the universities of Oslo and Copenhagen have asked: “if someone’s immune cells aren’t up to recognizing and fighting their tumours (i.e. ‘seeing’ neo-antigens), could someone else’s help?” It turns out that many more than 1 in 100 neo-antigens are able to cause an immune response. Even more exciting (and surprising), immune cells (T cells) from healthy donors can react to these neo-antigens and, in vitro at least (i.e. in cells grown in the laboratory), can kill tumour cells.

118. pic

Genetic modification of blood lymphocytes

T cells are isolated from a blood sample and novel genes inserted into their DNA. The engineered T cells are expanded and then infused into the patient. In the latest development T cells from healthy donors are screened for reactivity against neo-antigens expressed in a patient’s melanoma. T cell receptors that  recognise neo-antigens are sequenced and then transferred to the patient’s T cells.

How does that work?

T cells (lymphocytes) circulating in the blood act, in effect, as scouts, scanning the surface of all cells, including cancer cells, for the presence of any protein fragments on their surface that should not be there. The first contact with such foreign protein fragments switches on a process called priming that ultimately enables T cells to kill the aberrant cells (see Invisible Army Rouses Home Guard).

What the Scandinavian group did was to screen healthy individuals for tissue compatibility with a group of cancer patients. They then identified a set of 57 neo-antigens from three melanoma patients and showed that 11 of the 57 could stimulate responses in T cells from the healthy donors (T cells from the patients only reacted to two neo-antigens). Indeed the neo-antigen-specific T cells from healthy donors could kill melanoma cells carrying the corresponding mutated protein.

What can possibly go wrong?

The obvious question is, of course, how come cells from healthy folk have a broader reactivity to neo-antigens than do the cells of melanoma patients? The answer isn’t clear but presumably either cancers can make T cell priming inefficient or T cells become tolerant to tumours (i.e. they see them as ‘self’ rather than ‘non-self’).

And the future?

The more critical question is whether the problem can be short-circuited and Erlend Strønen and friends set about this by showing that T cell receptors in donor cells that recognize neo-antigens can be sequenced and expressed in the T cells of patients. This offers the possibility of a further type of adoptive cell transfer immunotherapy to the one we described in Gosh! Wonderful GOSH.

https://cancerforall.wordpress.com/2015/11/19/gosh-wonderful-gosh/

As one of the authors, Ton Schumacher, put it “Our findings show that the immune response in cancer patients can be strengthened; there is more on the cancer cells that makes them foreign that we can exploit. One way we consider doing this is finding the right donor T cells to match these neo-antigens. The receptor that is used by these donor T-cells can then be used to genetically modify the patient’s own T cells so these will be able to detect the cancer cells.”

And Johanna Olweus commented that “Our study shows that the principle of outsourcing cancer immunity to a donor is sound. However, more work needs to be done before patients can benefit from this discovery. Thus, we need to find ways to enhance the throughput. We are currently exploring high-throughput methods to identify the neo-antigens that the T cells can “see” on the cancer and isolate the responding cells. But the results showing that we can obtain cancer-specific immunity from the blood of healthy individuals are already very promising.”

References

Strønen, M. Toebes, S. Kelderman, M. M. van Buuren, W. Yang, N. van Rooij, M. Donia, M.-L. Boschen, F. Lund-Johansen, J. Olweus, T. N. Schumacher. Targeting of cancer neoantigens with donor-derived T cell receptor repertoires. Science, 2016.

“Fighting cancer with the help of someone else’s immune cells.” ScienceDaily. ScienceDaily, 19 May 2016.

Going With The Flow

The next time you happen to be in Paris and have a spare moment you might wander over to, or even up, the Eiffel Tower. The exercise will do you good, assuming you don’t have a heart attack, and you can extend your knowledge of science by scanning the names of 72 French scientists that you’ll find beneath the square thing that looks like a 1st floor balcony. Chances are you won’t recognize any of them: they really are History Boys – only two were still alive when Gustave Eiffel’s exhibit was opened for the 1889 World’s Fair.

One of the army of unknowns is a certain Michel Eugène Chevreul – and he’s a notable unknown in that he gave us the name of what is today perhaps the most familiar biological chemical – after DNA, of course. Although Chevreul came up with the name (in 1815) it was another Frenchman, François Poulletier de la Salle who, in 1769, first extracted the stuff from gallstones.

A few clues

The ‘stuff’ has turned out to be essential for all animal life. It’s present in most of the foods we eat (apart from fruit and nuts) and it’s so important that we actually make about one gram of it every day to keep up our total of some 35 grams – mostly to be found in cell membranes and particularly in the plasma membrane, the outer envelope that forms the boundary of each cell. The cell membrane protects the cell from the outside world but it also has to allow chemicals to get in and out and to permit receptor proteins to transmit signals across the barrier. For this it needs to be flexible – which why membranes are formed from two layers of lipids back-to-back. The lipid molecules have two bits: a head that likes to be in contact with water (blue blobs in picture) to which is attached two ‘tails’ ­– fatty acid chains (fatty acids are unbranched chains of carbon atoms with a methyl group (CH3–) at one end and a carboxyl group (–COOH) at the other).

Bilayer

Cholesterol_molecule_ball

A lipid bilayer                                          

De la Salle’s substance

 

The lipid ‘tails’ can waggle around, giving the plasma membrane its fluid nature and, to balance this, membranes contain roughly one molecule of ‘stuff’ for every lipid (the yellow strands in the lipid bilayer). As you can see from the model of the substance found by de la Salle, it has four carbon rings with a short, fatty acid-like tail (the red blob is an oxygen atom). This enables it to slot in between the lipid tails, strengthening the plasma membrane by making it a bit more rigid, so it’s harder for small molecules to get across unless there is a specific protein carrier.

Bilayer aThe plasma membrane. A fluid bilayer made of phospholipids and cholesterol permits proteins to diffuse within the membrane and allows flexibility in their 3D structures so that they can transport small molecules and respond to extracellular signals.


De la Salle’s ‘stuff’ has become famous because high levels have been associated with heart disease and much effort has gone into producing and promoting drugs that reduce its level in the blood. This despite the fact that numerous studies have shown that lowering the amount of ‘stuff’ in our blood has little effect on mortality. In fact, if you want to avoid cardiovascular problems it’s clear your best bet is to eat a Mediterranean diet (mostly plant-based foods) that will make no impact on your circulating levels of ‘stuff’.

By now you will have worked out that the name Chevreul came up with all those years ago is cholesterol and it will probably have occurred to you that it’s pretty obvious that our efforts to tinker with it are doomed to failure.

We’ve known for along time that if you eat lots of cholesterol it doesn’t make much difference to how much there is in your bloodstream – mainly because cholesterol in foods is poorly absorbed. What’s more, because it’s so important, any changes we try to make in cholesterol levels are compensated for by alterations the internal production system.

Given how important it is and the fact that we both eat and make cholesterol, it’s not surprising that quite complicated systems have evolved for carting it around the body and delivering it to the right places. These involve what you might think of as molecular container ships: called lipoproteins they are large complexes of lipids (including cholesterol) held together by proteins. The cholesterol they carry comes in two forms: cholesterol itself and cholesterol esters formed by adding a fatty acid chain to one end of the molecule – which makes them less soluble in water.

lipoprotein-structureChol est fig

Lipoprotein                                                               Cholesterol ester

Formed by an enzyme – ACAT –
adding a fatty acid to cholesterol.
Avasimibe blocks this step.

 

So famous has cholesterol become even its taxi service has passed into common language – almost everyone knows that high-density lipoproteins (HDLs) carry so-called ‘good cholesterol’ (back to the liver for catabolism) – low concentrations of these are associated with a higher risk of atherosclerosis. On the other hand, high concentrations of low-density lipoproteins (LDLs) go with increasing severity of cardiovascular disease – so LDLs are ‘bad cholesterol’.

What’s this got to do with cancer?

The evidence that cholesterol levels play a role in cancer is conflicting. A number of studies report an association between raised blood cholesterol level and various types of cancer, whilst others indicate no association or the converse – that low cholesterol levels are linked to cancers. However, the Cancer Genome Atlas (TCGA) that profiles DNA mutations and protein expression reveals that the activity of some genes involved in cholesterol synthesis reflect patient survival for some cancer types: increased cholesterol synthesis correlating with decreased survival. Perhaps that accounts for evidence that the class of cholesterol lowering drugs called statins can have anti-tumour effects.

In a recent development Wei Yang and colleagues from various centres in China have come up with a trick that links cholesterol metabolism to cancer immunotherapy. They used a drug (avasimibe) that blocks the activity of the enzyme that converts cholesterol to cholesterol ester (that’s acetyl-CoA acetyltransferase – ACAT1). The effect of the drug is to raise cholesterol levels in cell membranes, in particular, in killer T cells. As we’ve noted, this will make the membranes a bit more rigid and a side-effect of that is to drive T cell receptors into clusters.

One or two other things happen but the upshot is that the killer T cells interact more effectively with target tumour cells and toxin release by the T cells – and hence tumour cell killing – is more efficient. The anti-cancer immune response has been boosted.

Remarkably, it turned out that when mice were genetically modified so that their T cells lacked ACAT1, a subset of these cells (CD8+) up-regulated their cholesterol synthesis machinery. Whilst this seems a paradoxical response, it’s very handy because it is these CD8+ cells that kill tumour cells. Avasimibe has been shown to be safe for short-term use in humans but the genetic engineering experiments in mice suggest that a similar approach, knocking out ACAT1, could be used in human immunotherapy.

References

Yang, W. et al. (2016). Potentiating the antitumour response of CD8+ T cells by modulating cholesterol metabolism. Nature 531, 651–655.

Dustin, M.L. (2016). Cancer immunotherapy: Killers on sterols. Nature 531, 583–584.

 

Invisible Army Rouses Home Guard

Writing this blog – perhaps any blog – is an odd pastime because you never really know who, if anyone, reads it or what they get out of it. Regardless of that, one person that it certainly helps is me. That is, trying to make sense of the latest cancer news is one of the best possible exercises for making you think clearly – well, as clearly as I can manage!

But over the years one other rather comforting thing has emerged: more and more often I sit down to write a story about a recent bit of science only to remember that it picks up a thread from a piece I wrote months or sometimes years ago. And that’s really cheering because it’s a kind of marker for progression – another small step forward.

Thus it was with this week’s headline news that a ‘cancer vaccine’ might be on the way. In fact this development takes up more than one strand because it’s about immunotherapy – the latest craze – that we’ve broadly explained in Self Help Part-1Gosh! Wonderful GOSH and Blowing-up Cancer and it uses artificial nanoparticles that we met in Taking a Swiss Army Knife to Cancer.

Arming the troops

What Lena Kranz and her friends from various centres in Germany described is yet another twist on the idea of giving our inbuilt defence – i.e. the immune system – a helping hand to tackle tumours. They made small sacs of lipid called nanoparticles (they’re so small you could get 300 in the width of a human hair), loaded them with bits of RNA and injected them into mice. This invisible army of fatty blobs was swept around the circulatory system whereupon two very surprising things happened. The first was that, with a little bit of fiddling (trying different proportions of lipid and RNA), the nanoparticles were taken up by two types of immune cells, with very little appearing in any other cells. This rather fortuitous result is really important because it means that the therapeutic agent (nanoparticles) don’t need to be directly targetted to a tumour cell – thus avoiding one of the perpetual problems of therapy.

The second event that was not at all a ‘gimme’ was that the immune cells (dendritic cells and macrophages) were stimulated to make interferon and they also used the RNA from the nanoparticles as if it was their own to make the encoded proteins – a set of tumour antigens (tumour antigens are proteins made by tumour cells that can be useful in identifying the cells. A large number of have now been found: one group of tumour antigens includes HER2 that we met as a drug target in Where’s That Tumour?)

The interferon was released into the tumour environment in two waves, bringing about the ‘priming’ of T lymphocytes so that, interacting via tumour antigens, they can kill target cells. By contrast with taking cells from the host and carrying out genetic engineering in the lab (Gosh! Wonderful GOSH), this approach is a sort of internal re-wiring achieved by giving a sub-set of immune system cells a bit of genetic code (in the form of RNA).

TAgs RNA Nano picNanoparticle cancer vaccine. Tiny particles (made of lipids) carry RNA into cells of the immune system (dendritic cells and macrophages) in mice. A sub-set of these cells releases a chemical signal (interferon) that promotes the activation of T lymphocytes. The imported RNA is translated into proteins (tumour antigens) – that are presented to T cells. A second wave of interferon (released from macrophages) completes T cell priming so that they are able to attack tumour cells by recognizing antigens on their surface (Kranz et al. 2016; De Vries and Figdor, 2016).

So far Kranz et al. have only tried this method in three patients with melanoma. All three made interferon and developed strong T-cell responses. As with all other immunotherapies, therefore, it is early days but the fact that widely differing strategies give a strong boost to the immune system is hugely encouraging.

Other ‘cancer vaccines’

As a footnote we might add that there are several ‘cancer vaccines’ approved by the US Food and Drug Administration (FDA). These include vaccines against hepatitis B virus and human papillomavirus, along with sipuleucel-T (for the treatment of prostate cancer), and the first oncolytic virus therapy, talimogene laherparepvec (T-VEC, or Imlygic®) for the treatment of some patients with metastatic melanoma.

How was it for you?

As we began by pointing out how good writing these pieces to clarify science is for me, the question for those dear readers who’ve made it to the end is: ‘How did I do?’

References

Kranz, L.M. et al. (2016). Systemic RNA delivery to dendritic cells exploits antiviral defence for cancer immunotherapy. Nature (2016) doi:10.1038/nature18300.

De Vries, J. and Figdor, C. (2016). Immunotherapy: Cancer vaccine triggers antiviral-type defences.Nature (2016) doi:10.1038/nature18443.

 

New Era … Or Déjà vu?

 

Readers who follow events in the US of A – beyond the bizarre unfolding of the selection of the Republican Party’s nominee for President of the United States – may have noticed that the presidential incumbent put forward another of his bright ideas in the 2016 State of the Union Address. The plan launched by President Obama is to eliminate cancer and to this end $1 billion is to go into a national initiative with a strong focus on earlier detection, immunotherapy and drug combinations. It’s called a Moonshot’, presumably as a nod to President Kennedy’s 1961 statement that America should land a man on the moon (and bring him back!).011316_SOTU_THUMB_LARGE

A key aim of Moonshot is to improve all-round collaboration and to ‘bring about a decade’s worth of advances in five years.’ Part of this involvesbreaking down silos’ – which apparently is business-speak (and therefore a new one on me) for dealing with the problem of folk not wanting to share things with others in the same line of work. So someone’s spotted that science and medicine are not immune to this frailty.silo_mentality

On the home front …

In fact the President could be said to be slightly off the pace as, in October 2015, Cancer Research UK launched ‘Grand Challenges’ – a more modest (£100M) drive to tackle the most important questions in cancer. They’ve pinpointed seven problems and, helpfully, six of these will not be new to dedicated readers of these pages. They are:

  1. To develop vaccines (i.e. immunotherapy) to prevent non-viral cancers;
  2. To eradicate the 200,000 cancers caused each year by the Epstein Barr Virus;
  3. To understand the mutation patterns caused by different cancer-causing events;
  4. To improve early detection;
  5. To map the complexity of tumours at the molecular and cellular level;
  6. To find a way of targetting the cancer super-controller MYC;
  7. To work out how to target anti-cancer drugs to specific cells in the body.

{No/. 2 is the odd one out so it clearly hasn’t been too high a priority for me but we did talk about Epstein Barr Virus in Betrayed by Nature – phew!}.

But wait a minute

Readers of a certain age may be thinking this all sounds a bit familiar and, of course, they’re right. It was in 1971 that President Richard Nixon launched the ‘war on cancer’, the aim of which was to, er, to eliminate cancers. Given that 45 years on in the USA there’ll be more than 1.6 million new cases of cancer and 600,000 cancer deaths this year, it’s tempting to conclude that all we’ve learned is that things are a lot more complicated than we ever imagined.

Well, you can say that again. Of the several hundred genes that we now know can play a role in cancers, two are massively important MYC (‘mick’) and P53. Screen the scientific literature for research publications with one of those names in the title and you get, wait for it, over 50,000 for ‘MYC’ and for P53 over 168,000. It’s impossible to grasp how many hours of global sweat and toil went into churning out that amount of work – and that’s studies of just two bits of the jigsaw!

So 45 years of digging have yielded astonishing detail of the cellular and molecular biology – and that basis will prove essential to any rational approach to therapy. It’s a slow business this learning to walk before you run! But we can be rather more up-beat. Alongside all the science there have come considerable improvements in treatments. Thirty years ago one in four of those diagnosed with a cancer survived for more than 10 years. Now it’s almost one in two. But it’s a hugely variable picture: for breast cancer the 10 year overall survival rate is nearly 80% and for testicular cancer it’s over 98%. However, for lung cancer and cancer rates remain below 5% 1%, respectively. For these and other cancers there has been very little progress.

So 45 years of digging away have yielded astonishing detail of the cellular and molecular biology – and that basis will prove essential to any rational approach to therapy. It’s a slow business this learning to walk before you run! But we can be rather more up-beat. Alongside all the science there have come considerable improvements in treatments. Thirty years ago one in four of those diagnosed with a cancer survived for more than 10 years. Now it’s almost one in two. But it’s a hugely variable picture: for breast cancer the 10 year overall survival rate is nearly 80% and for testicular cancer it’s over 98%. However, for lung cancer and pancreatic cancer rates remain below 5% and 1%, respectively. For these and other cancers there has been very little progress.

All systems go?

Well, maybe. Moonshot is aimed at better and earlier diagnosis, more precise surgery and radiotherapy, and more drugs that can be better targeted. Oh, and bearing in mind that one in three cancers could be prevented, keeping plugging away at lifestyle factors.

How will it fare? Well, now we’re in the genomic era we can be sure that the facts mountain resulting from 45 years of collective toil will be as a molehill to the Everest of data now being mined and analysed. From that will emerge, we can assume with some confidence, a gradual refinement of the factors that are critical in determining the most effective treatment for an individual cancer.

Just recently we described in The Shape of Things to Come the astonishingly detailed picture that can be drawn of an individual tumour when it’s subjected to the full technological barrage now available. As we learn more about the critical factors, immunotherapy regimens will become more precise and the current response rate of about 10% of patients will rise.

Progress will still be slow, as we noted in The Shape of Things to Come – don’t expect miracles but, with lots of money, things will get better.

Gosh! Wonderful GOSH

Anyone who reads these pages will long ago, I trust, have been persuaded that the molecular biology of cells is fascinating, beautiful and utterly absorbing – and all that is still true even when something goes wrong and cancers make their unwelcome appearance. Which makes cancer a brilliant topic to talk and write about – you know your audience will be captivated (well, unless you’re utterly hopeless). There’s only one snag, namely that – perhaps because of the unwelcome nature of cancers – it’s tough to make jokes. One of the best reviews I had for Betrayed by Nature was terrifically nice about it but at the end, presumably feeling that he had to balance things up, the reviewer commented that it: “..is perhaps a little too light-hearted at times…” Thank you so much anonymous critic! Crikey! If I’d been trying to do slap-stick I’d have bunged in a few of those lewd chemicals – a touch of erectone, a bit of PORN, etc. (btw, the former is used in traditional Chinese medicine to treat arthritis and the latter is poly-ornithinine, so calm down).

I guess my serious referee may have spotted that I included a poem – well, two actually, one written by the great JBS Haldane in 1964 when he discovered he had bowel cancer which begins:

I wish I had the voice of Homer

To sing of rectal carcinoma,

Which kills a lot more chaps, in fact,
Than were bumped off when Troy was sacked.

Those couplets may reflect much of JBS with whom I can’t compete but, nevertheless, in Betrayed by Nature I took a deep breath and had a go at an update that began:

Long gone are the days of Homer
But not so those of carcinoma,
Of sarcoma and leukemia

And other cancers familia.
But nowadays we meet pre-school
That great and wondrous Molecule.
We know now from the knee of Mater
That DNA’s the great creator.

and went on:

But DNA makes cancer too

Time enough—it’ll happen to you.
“No worries sport” as some would say,
These days it’s “omics” all the way.

So heed the words of JBS

Who years ago, though in distress,
Gave this advice on what to do

When something odd happens to you:
“Take blood and bumps to your physician
Whose only aim is your remission.”

I’d rather forgotten my poem until in just the last week there hit the press a story illustrating that although cancer mayn’t be particularly fertile ground for funnies it does gloriously uplifting like nothing else. It was an account of how science and medicine had come together at Great Ormond Street Hospital to save a life and it was even more thrilling because the life was that of a little girl just two years old. The saga brought my poem to mind and it seemed, though I say it myself, rather spot on.

The little girl, Layla, was three months old when she was diagnosed with acute lymphoblastic leukemia (ALL) caused by a piece of her DNA misbehaving by upping sticks and moving to a new home on another chromosome – one way in which genetic damage can lead to cancer. By her first birthday chemotherapy and a bone marrow transplant had failed and the only remaining option appeared to be palliative care. At this point the GOSH team obtained special dispensation to try a novel immunotherapy using what are being called “designer immune cells“. Over a few months Layla recovered and is now free of cancer. However, there are no reports of Waseem Qasim and his colleagues at GOSH and at University College London dancing and singing the Trafalgar Square fountains – they’re such a reserved lot these scientists and doctors.

How did they do it?

In principle they used the gene therapy approach that, helpfully, we described recently (Self Help Part 2). T cells isolated from a blood sample have novel genes inserted into their DNA and are grown in the lab before infusing into the patient. The idea is to improve the efficiency with which the T cells target a particular protein (CD19) present on the surface of the leukemia cells by giving them artificial T cell receptors (also known as chimeric T cell receptors or chimeric antigen receptors (CARs) – because they’re made by fusing several bits together to make something that sticks to the target ‘antigen’ – CD19). The engineered receptors thereby boost the immune response against the leukemia. The new genetic material is inserted into a virus that carries it into the cells. So established is this method that you can buy such modified cells from the French biotech company Cellectis.

105 picAdoptive cell transfer immunotherapy. T cells are isolated from a blood sample and novel genes inserted into their DNA. The GOSH treatment also uses gene editing by TALENs to delete two genes. The engineered T cells are expanded, selected and then infused into the patient.

Is that all?

Not quite. To give themselves a better chance the team added a couple of extra tricks. First they included in the virus a second gene, RQR8, that encodes two proteins – this helps with identifying and selecting the modified cells. The second ploy is, perhaps, the most exciting of all: they used gene editing – a rapidly developing field that permits DNA in cells to be modified directly: it really amounts to molecular cutting and pasting. Also called ‘genome editing’ or ‘genome editing with engineered nucleases’ (GEEN), this form of genetic engineering removes or inserts sections of DNA, thereby modifying the genome.

The ‘cutting’ is done by proteins (enzymes called nucleases) that snip both strands of DNA – creating double-strand breaks. So nucleases are ‘molecular scissors.’ Once a double-strand break has been made the built-in systems of cells swing into action to repair the damage (i.e. stick the DNA back together as best it can without worrying about any snipped bits – these natural processes are homologous recombination and non-homologous end-joining, though we don’t need to bother about them here).

To be of any use the nucleases need to be targeted – made to home in on a specific site (DNA sequence) – and for this the GOSH group used ‘transcription activator-like effectors’ (TALEs). The origins of these proteins could hardly be further away from cancer – they come from a family of bacteria that attacks hundreds of different types of plants from cotton to fruit and nut trees, giving rise to things like citrus canker and black rot. About six years ago Jens Boch of the Martin-Luther-University in Halle and Adam Bogdanove at Iowa State University with their colleagues showed that these bugs did their dirty deeds by binding to regulatory regions of DNA thereby changing the expression of genes, hence affecting cell behavior. It turned out that their specificity came from a remarkably simple code formed by the amino acids of TALE proteins. From that it’s a relatively simple step to make artificial TALE proteins to target precise stretches of DNA and to couple them to a nuclease to do the cutting. The whole thing makes a TALEN (transcription activator-like effector nuclease). TALE proteins work in pairs (i.e. they bind as dimers on a target DNA site) so an artificial TALEN is like using both your hands to grip a piece of wood either side of the point where, using your third hand, you make the cut. The DNA that encodes the whole thing is inserted into plasmids that are transfected into the target cells; the expressed gene products then enter the nucleus to work on the host cell’s genome. There are currently three other approaches to nuclease engineering (zinc finger nucleases, the CRISPR/Cas system and meganucleases) but we can leave them for another time.

The TALENs made by the GOSH group knocked out the T cell receptor (to eliminate the risk of an immune reaction against the engineered T cells (called graft-versus-host disease) and CD52 (encodes a protein on the surface of mature lymphocytes that is the target of the monoclonal antibody alemtuzumab – so this drug can be used to prevent rejection by the host without affecting the engineered T cells).

What next?

This wonderful result is not a permanent cure for Layla but it appears to be working to stave off the disease whilst she awaits a matched T cell donor. It’s worth noting that a rather similar approach has been used with some success in treating HIV patients but it should be born in mind that, brilliant though these advances are, they are not without risks – for example, it’s possible that the vector (virus) that delivers DNA might have long-term effects – only time will tell.

Almost the most important thing in this story is what the GOSH group didn’t do. They used the TALENs gene editing method to knock out genes but it’s also a way of inserting new DNA. All you need to do is add double-stranded DNA fragments in the correct form at the same time and the cell’s repair system will incorporate them into the genome. That offers the possibility of being able to repair DNA damage that has caused loss of gene function – a major factor in almost all cancers. Although there is still no way of tackling the associated problem of how to target gene editing to tumour cells, it may be that Layla’s triumph is a really significant step for cancer therapy.

Reference

Smith, J. et al. (2015). UCART19, an allogeneic “off-the-shelf” adoptive T-cell immunotherapy against CD19+ B-cell leukemias. Journal of Clinical Oncology 33, 2015 (suppl; abstr 3069).

 

Holiday Reading (3) – Stopping the Juggernaut

The mutations that drive cancers fall into two major groups: those that reduce or eliminate the activity of affected proteins and those that have the opposite effect and render the protein abnormally active. It’s intuitively easy to see how the latter work: if a protein (or more than one) in a pathway that tells cells to proliferate becomes more efficient the process is accelerated. Less obvious is how losing an activity might have a similar effect but this comes about because the process by which one cell becomes two (called the cell cycle) is controlled by both positive and negative factors (accelerators and brakes if you will). This concept of a balancing act – signals pulling in opposite directions – is a common theme in biology. In the complex and ever changing environment of a cell the pressure to reproduce is balanced by cues that ask crucial questions. Are there sufficient nutrients available to support growth? Is the DNA undamaged, i.e. in a fit state to be replicated? If the answer to any of these questions is ‘no’ the cell cycle machinery applies the brakes, so that operations are suspended until circumstances change. The loss of negative regulators releases a critical restraint so that cells have a green light to divide even when they should not – a recipe for cancer.

Blanc sides.004

The cell cycle.

Cells are stimulated by growth factors to leave a quiescent state (G0) and enter the cell cycle – two growth phases (G1 & G2), S phase where DNA is duplicated and mitosis (M) in which the cells divide to give to identical daughter cells. Checkpoints can arrest progression if, for example, DNA is damaged. 

We’re all familiar with this kind of message tug-of-war at the level of the whole animal. We’ve eaten a cream cake and the schoolboy within is saying ‘go on, have another’ whilst the voice of wisdom is whispering ‘if you go on for long enough you’ll end up spherical.’

Because loss of key negative regulators occurs in almost all cancers it is a high priority to find ways of replacing inactivated or lost genes. Thus far, however, successful ‘gene therapy’ approaches have not been forthcoming with perhaps the exception of the emerging field of immunotherapy. The aim here is to boost the activity of the immune system of an individual – in other words to give an innate anti-cancer defense a helping hand. The immune system can affect solid cancers through what’s become known as the tumour microenvironment – the variety of cells and messengers that flock to the site of the abnormal growth. We’ve referred to these as ‘groupies’ and they include white blood cells. They’re drawn to the scene of the crime by chemical signals released by the tumour – the initial aim being to liquidate the intruder (i.e. tumour cells). However, if this fails, a two-way communication sees would-be killers converted to avid supporters that are essential for cancer development and spread.

Blanc sides.002

The tumour microenvironment. Tumour cells release chemical messengers that attract other types of cell, in particular those that mediate the immune response. If the cancer cells are not eliminated a two-way signaling system is established that helps tumour development.

There is much optimism that this will evolve into a really effective therapy but it is too early for unreserved confidence.

The obstacle of reversing mutations that eliminate the function of a gene has led to the current position in which practically all anti-cancer agents in use are inhibitors, that is, they block the activity of a protein (or proteins) resulting in the arrest of cell proliferation – which may ultimately lead to cell death. Almost all these drugs are not specific for tumour cells: they hit some component of the cell replication machinery and will block division in any cell they reach – which is why so many give rise to the side-effects notoriously associated with cancer chemotherapy. For example, the taxanes – widely used in this context – stick to protein cables to prevent them from pulling duplicated DNA strands apart so that cells, in effect, become frozen in final stages of division. Other classes of agent target different aspects of the cell cycle.

It is somewhat surprising that non-tumour specific agents work as well as they do but their obvious shortcomings have provided a major incentive for the development of ‘specific’ drugs – meaning ones that hit only tumour cells and leave normal tissue alone. Several of these have come into use over the past 15 years and more are in various stages of clinical trials. They’re specific because they knock out the activity of mutant proteins that are made only in tumour cells. Notable examples are Zelboraf® manufactured by Roche (hits the mutated form of a cell messenger – called BRAF – that drives a high proportion of malignant melanomas) and Gleevec® (Novartis AG: blocks a hybrid protein – BCR-ABL – that is usually formed in a type of leukemia).

These ‘targeted therapies’ are designed to not so much to poke the blancmange as to zap it by knocking out the activity of critical mutant proteins that are the product of cancer evolution. And they have produced spectacular remissions. However, in common with all other anti-cancer drugs, they suffer from the shortcoming that, almost inevitably, tumours develop resistance to their effects and the disease re-surfaces. The most remarkable and distressing aspect of drug resistance is that it commonly occurs on a timescale of months.

And being outwitted

Tumour cells use two tactics to neutralize anything thrown at them before it can neutralize them. One is to treat the agent as garbage and activate proteins in the cell membrane that pump it out. That’s pretty smart but what’s really staggering is the flexibility cells show in adapting their signal pathways to counter the effect of a drug blocking a specific target. Just about any feat of molecular gymnastics that you can imagine has been shown to occur, ranging from switching to other pathways in the signalling network to short-circuit the block, to evolving secondary mutations in the target mutant protein so that the drug can no longer stick to it. Launching specific drugs at cells may give them a mighty poke in a particularly tender spot, and indeed many cells may die as a result, but almost inevitably some survive. The blancmange shakes itself, comes up with a counter and gets down to business again. This quite extraordinary resilience of tumour cells derives from the infinite adaptability of the genome and we might do well to reflect that in trying to come up with anti-cancer drugs we are taking on an adversary that has overcome the challenges involved in generating the umpteen million species to have emerged during the earth’s lifetime.

Not the least disheartening aspect of this scenario is that when tumours recur after an initial drug treatment they are often more efficient at propagating themselves, i.e. more aggressive, than their precursors.

A Word From The Nerds

I went (a long time ago it has to be admitted) to what people call an ‘old-fashioned’ grammar school. It wasn’t really old-fashioned – we didn’t wear wigs and frock coats – it just put great emphasis in getting its kids into good universities. To this end we were, at an early stage, split into scientists and the rest (aka arts students). It was a bit more severe even than that because the ‘scientists’ were sub-divided: those considered bright did Maths, Chemistry and Physics whilst the rest did Biology instead of Maths (or anything instead of Maths). All of which was consistent with the view that biologists – and that includes medics – could get by without being able to add up. That was a long time ago, of course, but to some extent the myth lives on. In tutorials with first year medical students I found an ace way of inducing nervous breakdowns was to ask them to do a sum in their heads (“Put that calculator away Biggs minor”).

But times do change and when I asked a doctor the other day which branches of medical science required maths, he paused for moment and then said “All of them.” By that he meant that pretty well every area of current research relies on the application of mathematics. We hear much about DNA sequencing, genomics and its various offshoots but all of these need ‘bioinformaticists’ (whizzos at sums) to extract the useful grains form the vast mass of data generated. Much the same may be said of research in what are called imaging techniques – developing methods of detecting tumours – and there is now a vast subject in itself of ‘systems biology’ in which mathematical modeling is applied to complex biological events (e.g., signalling within cells) with the aim of being able to reconstruct what goes on – what folk like to call a holistic approach. A variation on this theme is studying how large populations of cells behave – for example, tumour cells when exposed to an anti-cancer drug. And that’s an important matter: if your drug kills off every cancer cell bar one but that one happens to be very good at reproducing itself, before long you’ll be back to square one. The way to avoid going round in circles is to detect and interrogate individual survivor cells to find out why they are such good escape artists.

Girls will be girls

All of which brings us to Franziska Michor. Born in Vienna of a michor2-d5f528c0eec02b1797c3028e48c17598.pngmathematician father who, she has recounted, told her and her sister that they had either to study maths or marry a mathematician. Sounds a frightening version of tradition to me – and it had perhaps the intended effect on the girls: frantic sprints to the nearest Department of Mathematics. That’s a bit unfair. As they say, some of my best friends are mathematicians – so they’re not at all the stereotypical distrait, inarticulate, socially inept weirdos. Although most of them are.

But Fräulein Michor was clearly one of the exceptions. She’s now a professor at the Dana-Farber Cancer Institute and Harvard School of Public Health in Boston and, with colleagues, she’s had a go at an important question: when cancer cells become resistant to a drug, is it because they acquire new mutations in their DNA or is it that some cells are already resistant and they are the ones that survive and grow. Their results suggest the simple answer is ‘the latter’ – resistant clones are present before treatment and they’re the survivors. So the upshot is clear but the route to it was very clever – not least because the maths involved in teasing out the answer is positively frightening. Fortunately (medics breathe a sigh of relief!) we can ignore the horrors of ‘Stochastic mathematical modeling using a nonhomogeneous continuous-time multitype birth–death process’ – yes, really – and just look at the biology, which was ingenious enough. To get at the answer they developed a tagging system that tracked the individual fates of over one million barcoded cancer cells under drug treatment.

Nerd picBarcoding cells. Strings of DNA 30 base pairs in length and of random sequence are artificially synthesized (coloured bars). These fragments are inserted in the genomes of viruses. The viruses infect cancer cells in culture and, after drug treatment, cells that survive (drug resistant) are harvested, their DNA is extracted and barcode DNA is detected (redrawn from Bhang et al. 2015).

Check this out!

Barcodes were pioneered by two young Americans, Bernard Silver and Norman Woodland, for automatically reading product information at checkouts and nowadays they’re used to mark everything from bananas to railway wagons and plane tickets. Their most familiar form is essentially a one-dimensional array that Woodland said he came up with by drawing Morse code in sand and just extending the dots and dashes to make narrow and wide lines.

120px-UPC-A-036000291452128px-PhotoTAN_mit_Orientierungsmarkierungen.svgbarcode n

 

 

 

 

Cellular barcoding uses the same idea but the ‘label’ is an artificial DNA sequence. Such is the power of the genetic code that a random string made up of 30 of its four distinct units (A, C, G & T) can essentially make an infinite number of different tags. Just like those on supermarket labels, two different codes look the same at first glance:

ACTCTGTGTCTCAGTGTGAGTGTCTGACTG

ACTGTCTGAGACAGAGAGTGTGACAGTCAG

The tags are made in an oligonucleotide synthesizer (a machine that sticks the units together) and then incorporated into virus backbones, just as we described for immunotherapy. The viruses (+ barcodes) then infect cells in culture, these are treated with a drug and the survivors present after a few weeks have their barcode DNAs sequenced. The deal here is that the number of different barcodes detected reflects the proportion of the original cell population that survived – and it indeed turned out that it’s very rare, pre-existing clones that are drug resistant. For one of the cell lines (derived from a human lung cancer) about one in 2,000 of the starting cell population showed resistance to the drug erlotinib.

Why?

The obvious question then is ‘What’s special about those few cells that they can thumb their noses at drugs that kill off most of their pals?’ To begin to get answers Bhang, Michor and colleagues noted that, for the lung cancer line, resistance to erlotinib occurs in cells that have multiple copies of a gene called MET – which makes a signalling protein. Exposing the cells to erlotinib and a MET inhibitor (crizotinib) greatly reduced the size of the resistant population (to one in 200,000).

This still leaves the question of the genetic alterations in that 0.0005% – and of course, finding drugs to target them. A further point is that this was a study of cells grown in the lab and it’s not possible to use this system in patients – but it could be used in mice to follow the development of implanted human tumours. If the causes of resistance can be tracked down it would open the way to using combinations of drugs that target both the bulk of tumour cells and the small sub-populations in which resistance lurks. That upshot would bring us to clinicians at the bedside (non-mathematicians!) – but not before running up a big debt to the maths geeks and in this case to a Viennese Dad who really did know best (offspring of the world please note!).

References

Bhang, H.C. et al. (2015). Studying clonal dynamics in response to cancer therapy using high-complexity barcoding. Nature Medicine 21, 440-448.

Blowing Up Cancer

To adapt the saying of the sometime British Prime Minister Harold Wilson, a month is a long time in cancer research. {I know, you’ve forgotten – as well you might. He was PM from 1964 to 1970 and again from 1974 to 1976. His actual words were “A week is a long time in politics”}. When I started to write the foregoing Self Helps (Parts 1 & 2) I had absolutely no intention of mentioning the subject of today’s sermon – viral immunotherapy. But how times change and a recent report has hit the headlines – so here goes.

The reason for my reticence is that this is not a new field – far from it. Folk have been trying to target tumour cells with active viruses for twenty years but efforts have foundered to the extent that the new report is the first time in the western world that a phase III trial (when a drug or treatment is first tested on large groups of people) of cancer “virotherapy” has definitively shown benefit for patients with cancer, although a virus (H101) made by the Shanghai Sunway Biotech Co. was licensed in China in 2005 for the treatment of a range of cancers.

Hard bit already done

I appreciate that getting the hang of immunotherapy in the two Self Helps wasn’t a total doddle – but it was worth it, wasn’t it, bearing in mind we’re dealing with life and death here. My friend and correspondent Rachel Bown had to resort to her GCSE biology notes (since she met me I think she keeps them on the coffee table) but is now up to speed.

Fortunately this bit is pretty easy to follow – it’s just an extension of the viral jiggery-pokery we met in Self Help Part 2. There we saw that using ‘disabled’ viruses is a neat way of getting new genetic material into cells. The viruses have key bits of their genome (genetic material) knocked out – so they don’t have any nasty effects and don’t replicate (make more of themselves) once inside cells. Inserting new bits of DNA carrying a therapeutic gene turns them into a molecular delivery service.

Going viral

In virotherapy there’s one extra wrinkle: the viruses, though ‘disabled’, still retain the capacity to replicate – and this has two effects. First, more and more virus particles (virions) are made in an infected cell until eventually it can hold no more and it bursts. The cell is done for – but a secondary effect is that the newly-made virions spill out and drift off to infect other cells. This amplifies the effect of the initial injection of virus and, in principle, will continue as long as there are cells to infect.

A new tool

The virus used is herpes simplex (HSV-1) of the relatively harmless type that causes cold sores and, increasingly frequently, genital herpes. The reason for this choice is that sometimes, not very often, science gets lucky and Mother Nature comes up with a helping hand. For HSV-1 it was the completely unexpected discovery that when you knock out one of its genes the virus becomes much more effective at replicating in tumour cells than in normal cells. That’s a megagalactic plus because, in effect, it means the virus targets tumour cells, thereby overcoming one of the great barriers to cancer therapy. In this study another viral gene was also deleted, which increases the immune response against infected tumour cells.

All this cutting and pasting (aka genetic engineering) is explained in entertaining detail in Betrayed by Nature but for now all that matters is that you end up with a virus that:

  1. Gets into tumour cells much more efficiently than into normal cells,
  2. Makes the protein encoded by the therapeutic gene, and
  3. Replicates in the cells that take it up until eventually they are so full of new viruses they go pop.

The finished product, if you can get your tongue round it, goes by the name of talimogene laherparepvec, mercifully shortened by the authors to T-VEC (made by Amgen). So T-VEC mounts a two-pronged attack – what the military would call a pincer movement. Infected tumour cells are killed (they’re ‘lysed’ by viral overload) and the inserted gene makes a protein that soups up the immune response – called GM-CSF (granulocyte macrophage colony-stimulating factor). The name doesn’t matter: what’s important is that it’s a human signaling molecule that stimulates the immune system, the overall result being production of tumour-specific T cells.

Fig. 1 Viral Therapy

Virotherapy. Model of a virus (top). The knobs represent proteins that enable the virus to stick to cells. Below: sequence of injecting viruses that are taken up by tumour cells that eventually burst to release new virions that diffuse to infect other tumour cells.

And the results?

The phase III trial, led by Robert Andtbacka, Howard Kaufman and colleagues from Rutgers Cancer Institute of New Jersey, involved 64 research centres worldwide and 436 patients with aggressive, inoperable malignant melanoma who received either an injection of T-VEC or a control immunotherapy. Just over 16% of the T-VEC group showed a durable response of more than six months, compared with 2% given the control treatment. About 10% of the patients treated had “complete remission”, with no detectable cancer remaining – considered a cure if the patient is still cancer-free five years after diagnosis.

Maybe this time?

We started with Harold Wilson and it was in between his two spells in Number 10 that President Nixon declared his celebrated ‘War on Cancer’, aimed at bringing the major forms of the disease under control within a decade or two. It didn’t happen, as we might have guessed. Back in 1957 in The Black Cloud the astrophysicist Sir Fred Hoyle has the line ‘I cannot understand what makes scientists tick. They are always wrong and they always go on.’ To be fair, it was a science fiction novel and the statement clearly is only partly true. But it’s not far off and in cancer there’s been rather few of the media’s beloved ‘breakthroughs’ and a great deal of random shuffling together with, overall, some progress in specific areas. Along the bumpy highway there have, of course, been moments of high excitement when some development or other has briefly looked like the answer to a maiden’s prayer. But with time all of these have fallen, if not by the wayside, at least into their due place as yet another small step for man. The nearest to a “giant leap for mankind” has probably been coming up with the means to sequence DNA on an industrial scale that is now having a massive impact on the cancer game.

When Liza Minnelli (as Sally Bowles in Cabaret) sings Maybe this time your heart goes out to the poor thing, though your head knows it’ll all end in tears. But this time, maybe, just maybe, the advent of cancer immunotherapy in its various forms will turn out to be a new era. Let us fervently hope so but, even if it does, the results of this Phase III trial show that a long struggle lies ahead before treatments arrive that have most patients responding.

We began Self Help – Part 1 with the wonderful William Coley and there’s no better way to pause in this story than with his words – reminding us of a bygone age when the scientist’s hand could brandish an artistic pen and space-saving editors hadn’t been invented:

“While the results have not been as satisfactory as one who is seeking perfection could wish, … when it comes to the consideration of a new method of treatment for malignant tumours, we must not wonder that a profession with memories overburdened with a thousand and one much-vaunted remedies that have been tried and failed takes little interest in any new method and shows less inclination to examine into its merits. Cold indifference is all it can expect, and rightly too, until it has something beside novelty to offer in its favour.”

References

Mohr, I. and Gluzman, Y. (1996). A herpesvirus genetic element which affects translation in the absence of the viral GADD34 function. The EMBO Journal 15, 4759–66.

Andtbacka, R.H.I. et al. (2015). Talimogene Laherparepvec Improves Durable Response Rate in Patients With Advanced Melanoma. 10.1200/JCO.2014.58.3377