Cancer GPS?

The thing that pretty well everyone knows about cancers is that most are furtive little blighters. They kill one in three of us but usually we don’t they’re there until they are big enough to make something go wrong in the body or to show up in our seriously inadequate screening methods. In that sense they resemble heart problems of one sort or another, where often the first indication of trouble is unexpectedly finding yourself lying on the floor.

Meanwhile, out on the highways and byways you are about 75 times less likely to be killed in an accident than you are to succumb to either cancers or circulation failure. Which is a way of saying that in the UK about 2000 of us perish on the roads each year. That it’s ‘only’ 2000 is presumably because here your assailant is anything but furtive. All you’ve got to do is side-step the juggernaut and you’ll probably live to be – well, old enough to get cancer.

Did you know, by the way, that ‘juggernaut’ is said to come from the chariots of the Jagannath Temple in Puri on the east coast of India. These are vast contraptions used to carry representations of Hindu gods on annual festival days that look as though walking pace would be too much for them. So, replace the monsters on our roads with real juggernauts! Problem largely solved!!

Flagging cancer

But to get back to cancer or, more precisely, the difficulty of seeing it. After centuries of failing to make any inroads, recent dramatic advances give hope that all is about to change. These rely on the fact that tissues shed cells – and with them DNA – into the circulation. Tumours do this too – so in effect they are scattering clues to their existence into blood. By using short stretches of artificial DNA as bait, it’s possible to fish out tumour cell DNA from a few drops of blood. That’s a pretty neat trick in itself, given we’re talking about fewer than 100 tumour cells in a sea of several billion other cells in every cubic millimeter of blood.

There are two big attractions in this ‘microfluidics’ approach. First it’s almost ‘non-invasive’ in needing only a small blood sample and, second, it is possible that indicators may be picked up long before a tumour would otherwise show up. In effect it’s taking a biochemical magnifying glass to our body to ask if there’s anything there that wouldn’t normally be present. Detect a marker and you know there’s a tumour somewhere in the body, and if the marker changes in concentration in response to a treatment, you have a monitor for how well that treatment is doing. So far, so good.

And the problem?

These ‘liquid biopsy’ methods that use just a teaspoonful of blood have been under development for several years but there has been one big cloud hanging over them. They appear to be exquisitely sensitive in detecting the presence of a cancer – by sequencing the DNA picked up – but they have not been able to pinpoint the tissue of origin. Until now.

Step forward epigenetics

Shuli Kang and colleagues at the University of California at Los Angeles and the University of Southern California have broken this impasse by turning to epigenetics. We noted in Twenty More Winks that an epigenetic modification is any change in DNA, other than in the sequence of bases (i.e. mutation), that affects how an organism develops or functions. They’re brought about by tacking small chemical groups (commonly methyl (CH3) groups) either on to some of the bases in DNA itself or on to the proteins (histones) that act like cotton reels around which DNA wraps itself. The upshot is small changes in the structure of DNA that affect gene expression. You can think of DNA methylation as a series of flags dotted along the DNA strand, decorating it in a seemingly random pattern. It isn’t random, of course, and the target for methylation is a cytosine nucleotide (C) followed by a guanine (G) in the linear DNA sequence – called a CpG site because G and C are separated by one phosphate (p). Phosphate links nucleosides together in the backbone of DNA.

Cancer cells often display abnormal DNA methylation patterns – excess methylation (hypermethylation) in some regions, reduced methylation in others – that contributes to their peculiar behavior. It’s possible to determine the methylation profile of a DNA sample (by a method called bisulfite sequencing).

Kang & Co. developed a computer program to analyse methylation profiles from solid tumours and healthy samples in public databases and compare them to patient DNA of unknown tissue origin.

The peaks represent CpG clusters that characterize normal cells (top) and a variety of cancers. The key point is that the different patterns identify the tissue of origin (from Kang, S. et al., 2017).

The program’s called CancerLocator and in this initial study it was used to test samples from patients with lung, liver or breast cancer. In the modest words of the authors, CancerLocator ‘vastly outperforms’ previous methods – mind you, they struggle to even to distinguish most cancer samples from non-cancer samples. Nevertheless, CancerLocator’s a big step forward, not least because it can detect early stage cancers with 80% accuracy.

It’s also reasonable to expect major improvements as methylation sequencing becomes more extensive and higher resolution reveals more subtle signatures. What’s more, in principle, it should be able to detect all types of cancers – meaning that, after all so many centuries we may at last have a way of side-stepping the juggernaut.

References

Kang, S. et al. (2017). CancerLocator: non-invasive cancer diagnosis and tissue-of-origin prediction using methylation profiles of cell-free DNA. Genome Biology DOI 10.1186/s13059-017-1191-5.

Advertisements

Through the Smokescreen

For many years I was lucky enough to teach in a cancer biology course for third year natural science and medical students. Quite a few of those guys would already be eyeing up research careers and, within just a few months, some might be working on the very topics that came up in lectures. Nothing went down better, therefore, than talking about a nifty new method that had given easy-to-grasp results clearly of direct relevance to cancer.

Three cheers then for Mikhail Denissenko and friends who in 1996 published the first absolutely unequivocal evidence that a chemical in cigarette smoke could directly damage a bit of DNA that provides a major protection against cancer. The compound bound directly to several guanines in the DNA sequence that encodes P53 – the protein often called ‘the guardian of the genome’ – causing mutations. A pity poor old Fritz Lickint wasn’t around for a celebratory drink – it was he, back in the 1930s, that first spotted the link between smoking and lung cancer.

This was absolutely brilliant for showing how proteins switched on genes – and how that switch could be perturbed by mutations – because, just a couple of years earlier, Yunje Cho’s group at the Memorial Sloan-Kettering Cancer Center in New York had made crystals of P53 stuck to DNA and used X-rays to reveal the structure. This showed that six sites (amino acids) in the centre of the P53 protein poked like fingers into the groove of double-stranded DNA.

x-ray-picCentral core of P53 (grey ribbon) binding to the groove in double-stranded DNA (blue). The six amino acids (residues) most commonly mutated in p53 are shown in yellow (from Cho et al., 1994).

So that was how P53 ‘talked’ to DNA to control the expression of specific genes. What could be better then, in a talk on how DNA damage can lead to cancer, than the story of a specific chemical doing nasty things to a gene that encodes perhaps the most revered of anti-cancer proteins?

The only thing baffling the students must have been the tobacco companies insisting, as they continued to do for years, that smoking was good for you.

And twenty-something years on …?

Well, it’s taken a couple of revolutions (scientific, of course!) but in that time we’ve advanced to being able to sequence genomes at a fantastic speed for next to nothing in terms of cost. In that period too more and more data have accumulated showing the pervasive influence of the weed. In particular that not only does it cause cancer in tissues directly exposed to cigarette smoke (lung, oesophagus, larynx, mouth and throat) but it also promotes cancers in places that never see inhaled smoke: kidney, bladder, liver, pancreas, stomach, cervix, colon, rectum and white blood cells (acute myeloid leukemia). However, up until now we’ve had very little idea of what, if anything, these effects have in common in terms of molecular damage.

Applying the power of modern sequencing, Ludmil Alexandrov of the Los Alamos National Lab, along with the Wellcome Trust Sanger Institute’s Michael Stratton and their colleagues have pieced together whole-genome sequences and exome sequences (those are just the DNA that encode proteins – about 1% of the total) of over 5,000 tumours. These covered 17 smoking-associated forms of cancer and permitted comparison of tobacco smokers with never-smokers.

Let’s hear it for consistent science!

The most obvious question then is do the latest results confirm the efforts of Denissenko & Co., now some 20 years old? The latest work found that smoking could increase the mutation load in the form of multiple, distinct ‘mutational signatures’, each contributing to different extents in different cancers. And indeed in lung and larynx tumours they found the guanine-to-thymine base-pair change that Denissenko et al had observed as the result of a specific chemical attaching to DNA.

For lung cancer they concluded that, all told, about 150 mutations accumulate in a given lung cell as a result of smoking a pack of cigarettes a day for a year.

Turning to tissues that are not directly exposed to smoke, things are a bit less clear. In liver and kidney cancers smokers have a bigger load of mutations than non-smokers (as in the lung). However, and somewhat surprisingly, in other smoking-associated cancer types there were no clear differences. And even odder, there was no difference in the methylation of DNA between smokers and non-smokers – that’s the chemical tags that can be added to DNA to tune the process of transforming the genetic code into proteins. Which was strange because we know that such ‘epigenetic’ changes can occur in response to external factors, e.g., diet.

What’s going on?

Not clear beyond the clear fact that tissues directly exposed to smoke accumulate cancer-driving mutations – and the longer the exposure the bigger the burden. For tissues that don’t see smoke its effect must be indirect. A possible way for this to happen would be for smoke to cause mild inflammation that in turn causes chemical signals to be released into the circulation that in turn affect how efficiently cells repair damage to their DNA.

raleighs_first_pipe_in_england-jpeg

Sir Walt showing off on his return                         to England

Whose fault it is anyway?

So tobacco-promoted cancers still retain some of their molecular mystery as well as presenting an appalling and globally growing problem. These days a popular pastime is to find someone else to blame for anything and everything – and in the case of smoking we all know who the front-runner is. But although Sir Walter Raleigh brought tobacco to Europe (in 1578), it had clearly been in use by American natives long before he turned up and, going in the opposite direction (à la Marco Polo), the Chinese had been at it since at least the early 1500s. To its credit, China had an anti-smoking movement by 1639, during the Ming Dynasty. One of their Emperors decreed that tobacco addicts be executed and the Qing Emperor Kangxi went a step further by beheading anyone who even possessed tobacco.

And paying the price

And paying the price

If you’re thinking maybe we should get a touch more Draconian in our anti-smoking measures, it’s worth pointing out that the Chinese model hasn’t worked out too well so far. China’s currently heading for three million cancer deaths annually. About 400,000 of these are from lung cancer and the smoking trends mean this figure will be 700,000 annual deaths by 2020. The global cancer map is a great way to keep up with the stats of both lung cancer and the rest – though it’s not for those of a nervous disposition!

References

Denissenko, M.F. et al. ( (1996). Preferential Formation of Benzo[a]pyrene Adducts at Lung Cancer Mutational Hotspots in P53.Science 274, 430–432.

Cho, Y. et al. (1994). Crystal Structure of a p53 Tumor Suppressor-DNA Complex: Understanding Tumorigenic Mutations. Science, 265, 346-355.

Alexandrov, L.D. et al. (2016). Mutational signatures associated with tobacco smoking in human cancer. Science 354, 618-622.

Re-writing the Manual of Life

A little while ago we talked about a fantastic triumph by a team at Great Ormond Street Hospital (Gosh! Wonderful GOSH) in using a form of immunotherapy to save a little girl. What they did was to take the T cells from a sample of her blood and use gene editing – molecular cutting and pasting – to remove some genes and add others before growing more of the cells and then putting them back into the patient.

Gene editing – genetic engineering that removes or inserts sections of DNA – uses engineered nucleases, enzymes that snip DNA but do so in a controlled way by homing in on a specific site (i.e. a defined sequence of As, Cs, Gs and Ts).

We mentioned that there are four main ways of doing this kind of engineering – the GOSH group used ‘transcription activator-like effectors’ (TALEs). However, the method that has made the biggest headlines is called CRISPR/Cas, and it has been very much in the news because a legal battle is underway to determine who did what in its development and who, therefore, will be first in line for a Nobel Prize.

Fortunately we can ignore such base pursuits and look instead at where this technology might be taking us.

What is CRISPR/Cas?

CRISPRs (pronounced crispers) are bits of DNA that contain short repetitions of base sequence, each next to a ‘spacer’ sequence. The spacers have accumulated in bacteria as a defence mechanism – they’re part of the bacterial immune system – and they’re identical to sequences found in viruses that infect microbes. In other words, the cunning bugs pick up bits of dangerous viruses to make a rogues gallery so they can recognize and attack those viruses next time they pop in.

Close to CRISPR sit genes encoding Cas proteins (enzymes that cut DNA, so they’re ‘nucleases’). When the CRISPR-spacer DNA is read by the machinery of the cell to make RNA, the spacer regions stick to Cas proteins and the whole complex, including the viral sequences, can roam the cell seeking a virus with genetic material that matches the CRISPR RNA. The CRISPR RNA sticks to the virus and Cas chops its DNA – end of virus. So Cas, by binding to CRISPR RNA, becomes an RNA-guided DNA cutter.

crispr-pic

CRISPR-CAS: Bug defence against invaders. Viruses can attack bacteria just as they can human cells. Over time bugs have evolved a cunning defence strategy: they insert short bits of viral DNA into their own genome (above). These contain repeated sequences of bases and each is followed by short segments of ‘spacer DNA’ (above). This happens next to DNA that encodes Cas proteins so that both are ‘read’ to make RNA (transcription). Cas proteins bind to spacer RNA, leaving the adjacent viral RNA free to attach to any complementary viral DNA it encounters. The Cas enzyme is thus guided to DNA that it can cleave. CRISPR stands for Clustered Regularly Interspaced Short Palindromic Repeats.

Why is CRISPR/Cas in the headlines?

We saw in Gosh! Wonderful GOSH how the Great Ormond Street Hospital team tinkered with DNA and in Self Help – Part 2 we summarized another way of doing this using viruses (notably a disabled form of the human immunodeficiency virus) to carry novel genes into cells.

A further arm of immunotherapy attempts to reverse an effect called checkpoint blockade whereby the immune system response to tumours is damped down – e.g. by using antibodies that target a protein called PD-1 (Self Help – Part 1).

Now comes news of a Chinese trial which will be the first time cells modified using CRISPR–Cas9 gene editing have been injected into people. The chap in charge is Lu You from Sichuan University’s West China Hospital in Chengdu and the plan is to take T cells from the blood patients with metastatic non-small cell lung cancer for whom chemotherapy, radiation therapy and other treatments have failed.

The target will be the PD-1 gene, the idea being that, if you want to stop PD-1 doing its stuff, far better than mucking about with antibodies is to just knock out its gene: no gene no protein! What could possibly go wrong?

Well, wonderful though CRISPR is, it doesn’t always hit the right target but in this trial the cells can be tested to make sure it’s the PD-1 gene that’s been zonked – so that shouldn’t be a problem. However, it’s a blockbuster in that all the multiplied T cells put back into the patient will be active – i.e. will have lost the PD-1 brake. Whilst that may be good for zonking tumours, goodness knows what it might do elsewhere.

The initial trial is on a small scale – just 10 people. If there are problems one possibility is to try to take the T cells from the site of the tumour, which might select those specifically targeting the tumour – not straightforward as lung cancers are difficult to get at.

Anyone for a DNA upgrade?

It’s hard to say where all this is leading. However, as Chinese scientists have already made the first CRISPR-edited human embryos and the first CRISPR-edited monkeys, the only safe bet is that China will be to the fore.

 

New Era … Or Déjà vu?

 

Readers who follow events in the US of A – beyond the bizarre unfolding of the selection of the Republican Party’s nominee for President of the United States – may have noticed that the presidential incumbent put forward another of his bright ideas in the 2016 State of the Union Address. The plan launched by President Obama is to eliminate cancer and to this end $1 billion is to go into a national initiative with a strong focus on earlier detection, immunotherapy and drug combinations. It’s called a Moonshot’, presumably as a nod to President Kennedy’s 1961 statement that America should land a man on the moon (and bring him back!).011316_SOTU_THUMB_LARGE

A key aim of Moonshot is to improve all-round collaboration and to ‘bring about a decade’s worth of advances in five years.’ Part of this involvesbreaking down silos’ – which apparently is business-speak (and therefore a new one on me) for dealing with the problem of folk not wanting to share things with others in the same line of work. So someone’s spotted that science and medicine are not immune to this frailty.silo_mentality

On the home front …

In fact the President could be said to be slightly off the pace as, in October 2015, Cancer Research UK launched ‘Grand Challenges’ – a more modest (£100M) drive to tackle the most important questions in cancer. They’ve pinpointed seven problems and, helpfully, six of these will not be new to dedicated readers of these pages. They are:

  1. To develop vaccines (i.e. immunotherapy) to prevent non-viral cancers;
  2. To eradicate the 200,000 cancers caused each year by the Epstein Barr Virus;
  3. To understand the mutation patterns caused by different cancer-causing events;
  4. To improve early detection;
  5. To map the complexity of tumours at the molecular and cellular level;
  6. To find a way of targetting the cancer super-controller MYC;
  7. To work out how to target anti-cancer drugs to specific cells in the body.

{No/. 2 is the odd one out so it clearly hasn’t been too high a priority for me but we did talk about Epstein Barr Virus in Betrayed by Nature – phew!}.

But wait a minute

Readers of a certain age may be thinking this all sounds a bit familiar and, of course, they’re right. It was in 1971 that President Richard Nixon launched the ‘war on cancer’, the aim of which was to, er, to eliminate cancers. Given that 45 years on in the USA there’ll be more than 1.6 million new cases of cancer and 600,000 cancer deaths this year, it’s tempting to conclude that all we’ve learned is that things are a lot more complicated than we ever imagined.

Well, you can say that again. Of the several hundred genes that we now know can play a role in cancers, two are massively important MYC (‘mick’) and P53. Screen the scientific literature for research publications with one of those names in the title and you get, wait for it, over 50,000 for ‘MYC’ and for P53 over 168,000. It’s impossible to grasp how many hours of global sweat and toil went into churning out that amount of work – and that’s studies of just two bits of the jigsaw!

So 45 years of digging have yielded astonishing detail of the cellular and molecular biology – and that basis will prove essential to any rational approach to therapy. It’s a slow business this learning to walk before you run! But we can be rather more up-beat. Alongside all the science there have come considerable improvements in treatments. Thirty years ago one in four of those diagnosed with a cancer survived for more than 10 years. Now it’s almost one in two. But it’s a hugely variable picture: for breast cancer the 10 year overall survival rate is nearly 80% and for testicular cancer it’s over 98%. However, for lung cancer and cancer rates remain below 5% 1%, respectively. For these and other cancers there has been very little progress.

So 45 years of digging away have yielded astonishing detail of the cellular and molecular biology – and that basis will prove essential to any rational approach to therapy. It’s a slow business this learning to walk before you run! But we can be rather more up-beat. Alongside all the science there have come considerable improvements in treatments. Thirty years ago one in four of those diagnosed with a cancer survived for more than 10 years. Now it’s almost one in two. But it’s a hugely variable picture: for breast cancer the 10 year overall survival rate is nearly 80% and for testicular cancer it’s over 98%. However, for lung cancer and pancreatic cancer rates remain below 5% and 1%, respectively. For these and other cancers there has been very little progress.

All systems go?

Well, maybe. Moonshot is aimed at better and earlier diagnosis, more precise surgery and radiotherapy, and more drugs that can be better targeted. Oh, and bearing in mind that one in three cancers could be prevented, keeping plugging away at lifestyle factors.

How will it fare? Well, now we’re in the genomic era we can be sure that the facts mountain resulting from 45 years of collective toil will be as a molehill to the Everest of data now being mined and analysed. From that will emerge, we can assume with some confidence, a gradual refinement of the factors that are critical in determining the most effective treatment for an individual cancer.

Just recently we described in The Shape of Things to Come the astonishingly detailed picture that can be drawn of an individual tumour when it’s subjected to the full technological barrage now available. As we learn more about the critical factors, immunotherapy regimens will become more precise and the current response rate of about 10% of patients will rise.

Progress will still be slow, as we noted in The Shape of Things to Come – don’t expect miracles but, with lots of money, things will get better.

The Shape of Things to Come?

One of the problems of trying to keep up with cancer – and indeed helping others to do so – is that you (i.e. ‘I’) get really irritated with the gentlemen and ladies of the press for going over the top in their efforts to cover science. I have therefore been forced to have a few rants about this in the past – actually, when I came to take stock, even I was a bit shocked at how many. Heading the field were Not Another Great Cancer Breakthough, Put A Cap On It and Gentlemen… For Goodness Sake. And not all of these were provoked by The Daily Telegraph!

If any of the responsible reporters read this blog they probably write me off as auditioning for the Grumpy Old Men tv series. But at least one authoritative voice says I’m really very sane and balanced (OK, it’s mine). Evidence? The other day I spotted the dreaded G word (groundbreaking) closely juxtaposed to poor old Achilles’ heel – and yes, it was in the Telegraph – but, when I got round to reading the paper, I had to admit that the work referred to was pretty stunning. Although, let’s be clear, such verbiage should still be banned.

A Tumour Tour de Force

The paper concerned was published in the leading journal Science by Nicholas McGranahan, Charles Swanton and colleagues from University College London and Cancer Research UK. It described a remarkable concentration of current molecular fire-power to dissect the fine detail of what’s going on in solid tumours. They focused on lung cancers and the key steps used to paint the picture were as follows:

1. DNA sequencing to identify mutations that produced new proteins in tumour cells (called tumour-associated antigens or ‘neoantigens’ – meaning molecular flags on the cell surface that can provoke an immune response – i.e. the host makes antibody proteins that react with (stick to) the antigens). Typically they found just over 300 of these ‘neoantigens’ per tumour – a reflection of the genetic mayhem that occurs in cancer.

2 tumoursVariation in neoantigen profile between two multi-region sequenced non-small cell lung tumours. There were approximately 400 (left) and 300 (right) neoantigens/tumour

  • Blue: proportion of clonal neoantigens found in every tumour region.
  • Yellow: subclonal neoantigens shared in multiple but not all tumour regions.
  • Red: subclonal (‘private’) neoantigens found in only one tumour region.
  • The left hand tumour (mostly blue, thus highly clonal) responded well to immunotherapy (from McGranahan et al. 2016).

2. Screening the set of genes that regulate the immune system – that is, make proteins that detect which cells belong to our body and which are ‘foreign.’ This is the human leukocyte antigen (HLA) system that is used to match donors for transplants – called HLA typing.

3. Isolating specialised immune cells (T lymphocytes) from samples of two patients with lung cancer, growing them in the lab to expand the population and testing how good these tumour-infiltrating cells were at recognizing the abnormal proteins (neo-antigens) on cancer cells.

4. Detecting proteins released by different types of infiltrating T cells that regulate the immune response. These include so-called immune checkpoint molecules that limit the extent of the immune response. This showed that T cell subsets that were very good at recognizing neo-antigens – and thus killing cancer cells (they’re CD8+ T cells or ‘killer’ T cells) also made high levels of proteins that restrain the immune response (e.g., PD-1).

5. Showing that immunotherapy (using the antibody pembrolizumab that reacts with PD-1) could significantly extend survival of patients with advanced non-small cell lung cancer. We’ve already met this approach in Self-help Part 1.

The critical finding was that the complexity of the tumour (called the clonal architecture) determines the outcome. Durable benefit from this immunotherapy requires a high level of mutation but a restricted range of neo-antigens. Put another way, tumours that are highly clonal respond best because they have common molecular flags present on every tumour cell.

6. Using the same methods on some skin cancers (melanomas) with similar results.

What did this astonishing assembly of results tell us?

It’s the most detailed picture yet of what’s going on in individual cancers. As one of the authors, Charles Swanton, remarked “This is exciting. This opens up a way to look at individual patients’ tumours and profile all the antigen variations to figure out the best ways for treatments to work. This takes personalised medicine to its absolute limit where each patient would have a unique, bespoke treatment.”

He might have added that it’s going to take a bit of time and a lot of money. But as a demonstration of 21st century medical science it’s an absolute cracker!

References

McGranahan et al. Clonal neoantigens elicit T cell immunoreactivity and sensitivity to immune checkpoint blockade. Science 10.1126/science.aaf490 (2016).

 

Bigger is Better

“Nonsense!” most males would cry, quite logically, given that we spend much of our time trying to persuade the opposite sex that size doesn’t matter. But we want to have it both ways: in the macho world of rugby one of the oldest adages is that ‘a good big ’un will always beat a good little ’un’.  Beethoven doubtless had a view about size – albeit unrecorded by history – but after he’d written his Eroica symphony, perhaps the greatest revolutionary musical composition of all, his next offering in the genre was the magical Fourth – scored for the smallest orchestra used in any of his symphonies. And on the theme of small can be good, the British Medical Journal, no less, has just told us that if we cut the size of food portions and put ’em on smaller plates we’ll eat less and not get fat!

Is bigger better?

Is bigger better?

All of which suggests that whether bigger is better depends on what you have in mind. Needless to say, in these pages what we have in mind is ‘Does it apply to cancer?’ – that is, because cancers arise from the accumulation in cells of DNA damage (mutations), it would seem obvious that the bigger an animal (i.e. the more cells it has) and the longer it lives the more likely it will be to get cancer.

Obvious but, this being cancer, also wrong.

Peto’s Paradox

The first person to put his finger on this point was Sir Richard Peto, most famous for his work with Sir Richard Doll on cancer epidemiology. It was Doll, together with Austin Bradford Hill, who produced statistical proof (in the British Doctors’ Study published in 1956) that tobacco smoking increased the risk of lung cancer. Peto joined forces with Doll in 1971 and they went on to show that tobacco, infections and diet between them cause three quarters of all cancers.

Whenever this topic comes up I’m tempted to give a plug to the unfortunate Fritz Lickint – long forgotten German physician – who was actually the first to publish evidence that linked smoking and lung cancer and who coined the term ‘passive smoking’ – all some 30 years before the Doll study. Lickint’s findings were avidly taken up by the Nazi party as they promoted Draconian anti-smoking measures – presumably driven by the fact that their leader, Gröfaz (to use the derogatory acronym by which he became known in Germany as the war progressed – from Größter Feldherr aller ZeitenGreatest Field Commander of all Time) was a confirmed non-smoker. Despite his usefulness, Lickint’s political views didn’t fit the ideology of the times. He lost his job, was conscripted, survived the war as a medical orderly and only then was able to resume his life as a doctor – albeit never receiving the credit he deserved.

Returning to Richard Peto, it was he who in 1975 pointed out that across different species the incidence of cancer doesn’t appear to be linked to the number of cells in animal – i.e. its size.   He based his notion on the comparison of mice with men – we have about 1000 times the number of cells in a mouse and typically live 30 times as long. So we should be about a million times more likely to get cancer – but in fact cancer incidence is another of those things where we’re pretty similar to our little furry friends. That’s Peto’s Paradox.

It doesn’t seem to apply within members of the same species, a number of surveys having shown that cancer incidence increases with height both for men and women. The Women’s Health Initiative found that a four inch increase in height raised overall cancer risk by 13% although for some forms (kidney, rectum, thyroid and blood) the risk went up by about 25%. A later study found a similar association for ovarian cancer: women who are 5ft 6in tall have a 23% greater risk than those who only make it to 5 feet. A similar risk links ovarian cancer to obesity (i.e. a rise in body mass index from 20 (slim) to 30 (slightly overweight) puts the risk up by 23%). Statistically sound though these results appear to be, it’s worth nothing that, as my colleague Paul Pharoah has pointed out, these risk changes are small. For example, the ovarian cancer finding translates to a lifetime risk of about 16-in-a-1000 for shorter women going up to 20-in-a-1000 as they rise by 6 inches.

It’s true that there may be a contribution from larger animals having bigger cells (whale red blood cells are about twice as big as those of the mouse) that divide more slowly but at most that effect seems small and doesn’t fully account for the fact that across species the association of size and age with cancer breaks down: Peto’s Paradox rules – humans are much more likely to get cancer than whales.

What did we know?

Well, since Peto picked up the problem, almost nothing about underlying causes. The ‘almost’ has been confined to the very small end of the scale and we’ve already met the star of the show – the naked mole rat – a rather shy chap with a very long lifespan (up to 30 years) but who never seems to get cancer. In that piece we described the glimmerings of an explanation but, thanks to Xiao Tian and colleagues of the University of Rochester, New York we now know that these bald burrowers make an extraordinarily large version of a polysaccharide (a polymer of sugars). These long strings of glucose-like molecules (called hyaluronan) form part of the extracellular matrix and regulate cell proliferation and migration. They’re enormous molecules with tens of thousands of sugars linked together but the naked mole rat makes versions about four times larger than those of mice or humans – and it seems that these extra-large sugar strings restrict cell behaviour and block the development of tumours.

Going up!

Our ignorance has just been further lifted with two heavyweight studies, one from Lisa Abegglen, Joshua Schiffman and chums from the University of Utah School of Medicine who went to the zoo (San Diego Zoo, in fact) and looked at 36 different mammalian species, ranging in size from the striped grass mouse (weighing in at 50 grams) to the elephant – at 4,800 kilogram nearly 100,000 times larger. They found no relationship between body size and cancer incidence, a result that conforms to Peto’s paradox. Comparing cancer mortality rates it transpires that the figure for elephants is less than 5% compared with the human range of 11% to 25%.

107 final pic

Cancer incidence across species by body size and lifespan. A selection of 20 of the 36 species studied is shown. Sizes range from the striped grass mouse to the elephant. As the risk of cancer depends on both the number of cells in the body and the number of years over which those cells can accumulate mutations, cancer incidence is plotted as a function of size (i.e. mass in grams × life span, years: y axis: log scale). Each species is represented by at least 10 animals (from Abegglen et al., 2015).

It can be seen at a glance that cancer incidence is not associated with mass and life span.

The Tasmanian devil stands out as a remarkable example of susceptibility to cancer through its transmission by biting and licking.

How does Jumbo do it?

In a different approach to Peto’s Paradox, Michael Sulak, Vincent Lynch and colleagues at the University of Chicago looked mainly at elephants – more specifically they used DNA sequencing to get at how the largest extant land mammal manages to be super-resistant to cancer. In particular they focused on the tumor suppressor gene P53 (aka TP53) because its expression is exquisitely sensitive to DNA damage and when it’s switched on the actions of the P53 protein buy time for the cell to repair the damage or, failing that, bring about the death of the cell. That’s as good an anti-cancer defence as you can imagine – hence P53’s appellation as the ‘guardian of the genome’. It turned out that elephants have no fewer than 20 copies of P53 in their genome, whereas humans and other mammals have only one (i.e. one copy per set of (23) chromosomes). DNA from frozen mammoths had 14 copies of P53 but manatees and the small furry hyraxes, the elephant’s closest living relatives, like humans have only one.

The Utah group confirmed that elephants have, in addition to one normal P53 gene, 19 extra P53 genes (they’re actually retrogenes – one type of the pseudogenes that we met in the preceding post) that have been acquired as the animals have expanded in size during evolution. Several of these extra versions of P53 were shown to be switched on (transcribed) and translated into proteins.

Consistent with their extra P53 fire-power, elephant cells committed P53-dependent suicide (programmed cell death, aka apoptosis) more frequently than human cells when exposed to DNA-damaging radiation. This suggests that elephant cells are rather better than human cells when it comes to killing themselves to avoid the risk of uncontrolled growth arising from defective DNA.

More genes anyone?

Those keen on jumping on technological bandwagons may wish to sign up for an extra P53 gene or two, courtesy of genetic engineering, so that bingo! – they’ll be free of cancers. Aside from the elephant, they may be encouraged by ‘super P53’ mice that were genetically altered to express one extra version of P53 that indeed significantly protected from cancer when compared with normal mice – and did so without any evident ill-effects.

We do not wish to dampen your enthusiasm but would be in dereliction of our duty is we did not add a serious health warning. We now know a lot about P53 – for example, that the P53 gene encodes at least 15 different proteins (isoforms), some of which do indeed protect against cancer – but there are some that appear to act as tumour promoters. In other words we know enough about P53 to realize that we simply haven’t a clue. So we really would be playing with fire if we started tinkering with our P53 gene complement – and to emphasise practicalities, as Mel Greaves has put it, we just don’t know how well the elephants’ defences would stack up if they smoked.

Nevertheless, on the bright side, light is at long last beginning to be shed on Peto’s Paradox and who knows where that will eventually lead us. Meanwhile Richard Peto’s activities have evolved in a different direction and he now helps to run a Thai restaurant in Oxford, a cuisine known for small things that pack a prodigious punch. Bit like Beethoven’s Fourth you could say.

a-gem-of-a-find-in-oxford

References

Peto, R. et al. (1975). Cancer and ageing in mice and men. British Journal of Cancer 32, 411-426.

Doll, R. and Peto, R. (1976). Mortality in relation to smoking: 20 years’ observations on male British doctors. Br Med J. 2(6051):1525–36.

Maciak, S. and Michalak, P. (2015). “Cell size and cancer: A new solution to Peto’s paradox?”. Evolutionary Applications 8: 2.

Doll, R. and Hill, A.B. (1954). “The mortality of doctors in relation to their smoking habits”. BMJ 328 (7455): 1529.

Doll, R. and Hill, A.B. (November 1956). “Lung cancer and other causes of death in relation to smoking; a second report on the mortality of British doctors”. British Medical Journal 2 (5001): 1071–1081.

Tian, X. et al. (2013). High-molecular-mass hyaluronan mediates the cancer resistance of the naked mole rat. Nature 499, 346-349.

Abegglen, L.M., Schiffman, J.D. et al. (2015). Potential Mechanisms for Cancer Resistance in Elephants and Comparative Cellular Response to DNA Damage in Humans. JAMA. doi:10.1001/jama.2015.13134.

Sulak, M., Lindsey Fong, Katelyn Mika, Sravanthi Chigurupati, Lisa Yon, Nigel P. Mongan, Richard D. Emes, Vincent J. Lynch, V.J. (2015). TP53 copy number expansion correlates with the evolution of increased body size and an enhanced DNA damage response in elephants. doi: http://dx.doi.org/10.1101/028522.

García-Cao, I. et al. (2002). ‘Super p53’ mice exhibit enhanced DNA damage response, are tumor resistant and age normally. EMBO Journal 21, 6225–6235.

Guess Who’s Coming to Dinner?

 

Question: when is a gene not a gene? Answer: when it’s a pseudogene.

Genes are familiar enough these days when the acronym DNA has become part of everyday speech “It is in Toyota’s DNA that mistakes made once will not be repeated”, as the CEO of Toyota rather sinisterly remarked. You could say that’s pseudo-scientific rubbish but, despite that kind of liberty-taking, most will know that a gene is a stretch of our genetic material (DNA) that carries the code to make a closely related RNA molecule that, in turn, may be used as a template to make a protein ­– it’s the molecular unit of heredity. Well known too is that the Greeks gave us ‘pseudo’ – but what’s a ‘lying’ or ‘false’ gene – and who cares?

No prizes for guessing that we should all be interested because it’s emerging that pseudogenes can be important players in cancer.

Player’s biography

Pseudogenes are somewhat disreputable because they are relatives of normal genes that along the evolutionary highway have become dysfunctional by losing the capacity to be ‘expressed’ – that is, their code can no longer be transformed into RNA and protein. You could think of them as an example of the shambolic way in which species have evolved by random happenstance so that they work in their own particular niches. And if you want the outstanding example of unintelligent design, look no further than yourself, as we did in Holiday Reading (2), Poking the Blancmange.

Just for background, although it doesn’t affect the main story, there are three ways in which our genome can acquire a pseudogene:

1. A normal gene becomes functionally extinct: odd mutational events disable the stretches of DNA that control its expression. The gene is like a siding on a railway that isn’t used for years and years until eventually the points  seize up (it would be a ‘switch’ on US railroads) and the cell machinery can no longer get at it – but when this does happen we get by without that gene.

2. During evolution genes quite often get duplicated – giving multiple copies: if one of these loses its regulatory bits the duplicate gene is switched off – it’s become a ghost.

3. We owe about 8% of our genome to viruses – mainly those with RNA genomes (retroviruses) whose life-cycle turns their RNA into DNA that has then been stuck into our genome. And that’s a lot (about 100,000 bits of retrovirus DNA) especially bearing in mind that only about 1% of our genome encodes proteins.

So our precious genome is littered with corpses and fragments thereof. In the past there’s been a regrettable tendency to label this material as ‘junk’ but increasingly we’re now discovering that there may be genetic life after death, so to speak. It’s not surprising if you think about it. If random events can inactivate a gene then they might do the reverse, even if that may be a much rarer event. And indeed it’s now clear that pseudogenes can be brought back to life through the random mutational events that characterise the rough and tumble of cellular life.

So not all pseudogenes are extinct then?

Correct. Obviously we wouldn’t be wittering on about them had not some bright sparks just shown that pseudogenes – or at least one in particular – can be re-awakened to play a part in cancer. The luminaries are Florian Karreth, Pier Paolo Pandolfi and friends from all over the place (USA, UK, Italy, Singapore) who found that a pseudogene called BRAFP1 (a relative of the normal BRAF gene) can help to drive cancer development. Some earlier studies had shown that BRAFP1 was expressed (i.e. RNA was made from DNA) in various human tumours but Karreth & Co extended this, detecting significant levels of the pseudogene RNA in lymphomas and thyroid tumours and also in cells from melanoma, prostate cancer and lung cancer, whilst it’s not switched on in the corresponding normal cells.

To show that this pseudogene can drive cancers they genetically engineered its over-expression in mice, whereupon the animals developed an aggressive malignancy akin to human lymphoma (specifically diffuse large B cell lymphoma). Short-circuiting an enormous amount of work, it emerged that the pseudogene up-regulated a signaling pathway involving its normal counterpart, BRAF, that drives proliferation.

106 pic

How a pseudogene (BRAFP1) might drive cancer. Top: The scheme illustrates the ‘central dogma’ of molecular biology: DNA makes RNA makes protein. In normal cells a family of micro RNAs (different coloured wiggles) regulate the level of BRAF RNA and hence of BRAF protein (above white line).  Bottom: When the pseudogene BRAFP1 is switched on its RNA competes for the negative regulators: the result is more BRAF RNA making more BRAF protein – making cancer (Karreth et al., 2015).

Interfering RNA

The pseudogene’s RNA manages to interfere with normal control by targeting another type of RNA – micro RNAs, so called because they’re very short (about 20 bases (units) long – so they’re encoded by tiny stretches of the over 3,000 million units that make up the genome). Small they may be but there are hundreds of them and it’s become clear over the last few years that they play critical roles in regulating how much protein is made from specific RNAs. Their method is simple: they recognize (i.e. bind to) stretches of RNA that encode proteins, thereby blocking translation into protein.

Karreth & Co showed that there are about 40 different micro RNAs that can stick to the RNAs encoding BRAF or BRAFP1. Normally when there’s no (or very little) BRAFP1 around they have only BRAF to act on – and their role is to control the proliferation signal it transmits – i.e. to keep that signal to what’s required for normal cell growth control. BUT, when the pseudogene RNA is made in significant amounts the attentions of the 40 micro RNAs are divided. Result: more BRAF RNA, more BRAF protein, higher cell proliferation.

It’s a bit like you’re just sitting down to a family dinner for four when there’s a knock on the door and in walks long lost Uncle Bert, complete with wife and two kids in tow. Of course you invite them to dine too – but now a meal for four has to stretch to eight. There is something for everybody – just not as much. Similarly for the regulators of BRAF: when BRAFP1 is present there’s half as much of the RNA regulators for each – and the result, bearing mind that they are negative regulators, is that the activity of BRAF goes up and the cells proliferate more avidly. The pseudogene is driving cancer.

First but not last

For decades pseudogenes were thought of as ‘junk’ DNA along with most of the rest of the genome that didn’t encode proteins – though I might say that was a concept I never promoted. Beware labeling anything in our genome as junk for it may rise, Kraken like, to remind us of our ignorance. And, now that one pseudogene has come in from the cold and been shown to drive some cancers, you can be confident that others will follow.

References

Karreth, F.A. et al. (2015). The BRAF Pseudogene Functions as a Competitive Endogenous RNA and Induces Lymphoma In Vivo. Cell 161, 319–332.

Lethal ZIP codes

In Keeping Cancer Catatonic we retailed how, over 125 years ago, the London physician Stephen Paget came up with his ‘seed and soil’ idea to explain why it was that when cancers spread to distant sites around the body by getting into the circulation they didn’t simply stick to the first tissue they came across. Paget had spotted that cancers tend to have preferred sites for spreading: tumours of the eye tend to travel to the liver, rather than the much handier brain, and breast cancers, Paget’s speciality, commonly spread to the liver but also to the lungs, kidneys, spleen and bone. So his idea was that certain distant secondary sites are somehow made more receptive to tumor growth, just as soil can be prepared for seeds to sprout.

So the key question became ‘how?’ and it’s hung in the cancer air for well over a century during which we’ve made very little progress towards an answer – and it is crucial because the business of tumour cells spreading (metastasizing) causes most cancer deaths (over 90%).

But, at long last, things have started to move, largely due to the efforts of David Lyden and his colleagues at Weill Cornell Medical College. Their first astonishing contribution was to show that cells in primary tumours release messengers into the circulation and these, in effect, tag what will become landing points for wandering tumour cells – i.e., the target sites are determined before any tumour cells actually set foot outside the confines of the primary tumour.

After that seismic revelation the story advanced a step further (in Scattering the Bad Seed) with some molecular detail of how the sites are marked – an effect Lyden has christened ‘Bookmarking cancer’ – and how when tumour cells do settle in their new niche they may be kept dormant for many years before starting to expand.

Carrying the flag

The next chapter in the story, as retailed in Holiday Reading (4) – Can We Make Resistance Futile?, revealed that the message is carried by small sacs – like little cells – called exosomes that are released from tumour cells. These float around the circulation until they find their target site, whereupon they plant the flag by setting off a chain reaction that produces a sticky protein – fibronectin – a kind of glue for immune cells and tumour cells.

That is all truly amazing stuff but, as we noted in Holiday Reading (4) – Can We Make Resistance Futile?, a recurring theme in science is that one answer merely poses the next question – in this case ‘what’s the messenger?’

As in all the best thrillers, the authors have kept us in suspense to the last, helped presumably by their not knowing the answer. But in this week’s Nature (Oct. 28, 2015) comes the denoument to this whodunit.

Mister postman look and see …

Many moons ago an outfit called the Marvelettes had a No. 1 hit with Please Mr. Postman and somewhat later the Fab Four did a re-hash that met with equal success. Perhaps we should have asked them how nature would go about directing little packages around the body. John, Ringo and the lads would, with their earthy, Liverpudlian logic, have pointed out the triviality of the problem of exosome addressing. ‘It’s not like you’re sending stuff all over the world, is it? You’ve only got a few targets – the major organs of the body. So a dead simple code will do. You know your messengers are proteins – ’coz they do everything – OK? So, pick a protein that comes in two bits with a few variants of each: mix and match and there’s yer postcodes. Now … what was that ditty about yellow subsurface vessels …’

And so it came to pass …

And the messenger is …

A family of proteins called integrins whose job is to span the membranes of cells, thereby promoting cell-cell interactions. They are indeed made of two different chains stuck together (called α (alpha) and β (beta)) and the upshot is that our cells can make about 24 unique integrins – more than enough to form a coded address system to direct tumour cells around the body. Well done lads!

What Ayuko Hoshino, David Lyden and their many collaborators did was to tag exosomes released from various types of cancer cell with a fluorescent dye and inject them into mice. The fluorescent label enabled them to track the exosomes and it turned out that, for a variety of cancer cells (breast, pancreatic, colorectal, lung, melanoma and pediatric) the exosomes travelled to the organs associated with metastasis (e.g., breast cancer exosomes stuck in the lungs, pancreatic cancer exosomes in the liver, etc). In other words exosome spread mimicked the pattern of the tumour from which they were derived. Once they had landed the exosomes set about reprogramming the organ sites to make a fertile microenvironment capable of supporting tumor cell growth in a new colony.

When they looked at the exosome proteins they found a particular member of the integrin family flagged each organ-specific site. Thus α6β4 promotes lung metastasis, αvβ5 homes in on the liver, αvβ3 on the brain, etc.

MapFinding a home

To spread around the body (metastasise) primary tumours first release small sacs (exosomes) carrying protein tags (integrins). Moving through the circulatory system the integrin tags home in to specific addresses found on different organs. The effect of exosomes sticking to target sites is to prepare the ground for cells released by the tumour to adhere and colonise.

Down the tube

You could think of primary tumours as being a bit like us when we move to a new city and try to find a des. res. in a place you don’t know. We could just ramble round the subway system until something catches our eye but that might take for ever. Much more efficient is to ask someone with local knowledge where would be good spots to target. For disseminating tumours their exosomes are the scouts who do the foot-slogging: the protein signatures on the surface of these small, tumour-secreted packages home in on postcodes that define a desirable locale for metastatic spread.

Shooting the messenger

An obvious question is ‘If exosomes are critical in defining metastatic sites, can you block their action – and what happens when you do?’ In preliminary experiments Hoshino & Co showed that either knockdown of specific integrins or blocking the capacity of these proteins to stick to their targets (with a specific antibody or short synthetic peptides) significantly reduced exosome adhesion, thereby blocking pre-metastatic niche formation and liver metastasis.

A new beginning?

We described these fabulous results as the denouement but, of course, it isn’t. As Mr. Churchill remarked in a somewhat different context: ‘Now this is not the end.’ It is rather a step to answering an old question but it’s incredibly exciting. If screening for exosomes leads to the detection of cancer not just years but perhaps decades earlier than can be achieved by present methods and if blocking their action can keep metastasis at bay, then the field of cancer will be utterly transformed.

References

Hoshino, A. et al. (2015). Tumour exosome integrins determine organotropic metastasis. Nature doi:10.1038/nature15756.

Ruoslahti, E. (1996). RGD and Other Recognition Sequences for Integrins. Annual Review of Cell and Developmental Biology 12, 697-715.

A Word From The Nerds

I went (a long time ago it has to be admitted) to what people call an ‘old-fashioned’ grammar school. It wasn’t really old-fashioned – we didn’t wear wigs and frock coats – it just put great emphasis in getting its kids into good universities. To this end we were, at an early stage, split into scientists and the rest (aka arts students). It was a bit more severe even than that because the ‘scientists’ were sub-divided: those considered bright did Maths, Chemistry and Physics whilst the rest did Biology instead of Maths (or anything instead of Maths). All of which was consistent with the view that biologists – and that includes medics – could get by without being able to add up. That was a long time ago, of course, but to some extent the myth lives on. In tutorials with first year medical students I found an ace way of inducing nervous breakdowns was to ask them to do a sum in their heads (“Put that calculator away Biggs minor”).

But times do change and when I asked a doctor the other day which branches of medical science required maths, he paused for moment and then said “All of them.” By that he meant that pretty well every area of current research relies on the application of mathematics. We hear much about DNA sequencing, genomics and its various offshoots but all of these need ‘bioinformaticists’ (whizzos at sums) to extract the useful grains form the vast mass of data generated. Much the same may be said of research in what are called imaging techniques – developing methods of detecting tumours – and there is now a vast subject in itself of ‘systems biology’ in which mathematical modeling is applied to complex biological events (e.g., signalling within cells) with the aim of being able to reconstruct what goes on – what folk like to call a holistic approach. A variation on this theme is studying how large populations of cells behave – for example, tumour cells when exposed to an anti-cancer drug. And that’s an important matter: if your drug kills off every cancer cell bar one but that one happens to be very good at reproducing itself, before long you’ll be back to square one. The way to avoid going round in circles is to detect and interrogate individual survivor cells to find out why they are such good escape artists.

Girls will be girls

All of which brings us to Franziska Michor. Born in Vienna of a michor2-d5f528c0eec02b1797c3028e48c17598.pngmathematician father who, she has recounted, told her and her sister that they had either to study maths or marry a mathematician. Sounds a frightening version of tradition to me – and it had perhaps the intended effect on the girls: frantic sprints to the nearest Department of Mathematics. That’s a bit unfair. As they say, some of my best friends are mathematicians – so they’re not at all the stereotypical distrait, inarticulate, socially inept weirdos. Although most of them are.

But Fräulein Michor was clearly one of the exceptions. She’s now a professor at the Dana-Farber Cancer Institute and Harvard School of Public Health in Boston and, with colleagues, she’s had a go at an important question: when cancer cells become resistant to a drug, is it because they acquire new mutations in their DNA or is it that some cells are already resistant and they are the ones that survive and grow. Their results suggest the simple answer is ‘the latter’ – resistant clones are present before treatment and they’re the survivors. So the upshot is clear but the route to it was very clever – not least because the maths involved in teasing out the answer is positively frightening. Fortunately (medics breathe a sigh of relief!) we can ignore the horrors of ‘Stochastic mathematical modeling using a nonhomogeneous continuous-time multitype birth–death process’ – yes, really – and just look at the biology, which was ingenious enough. To get at the answer they developed a tagging system that tracked the individual fates of over one million barcoded cancer cells under drug treatment.

Nerd picBarcoding cells. Strings of DNA 30 base pairs in length and of random sequence are artificially synthesized (coloured bars). These fragments are inserted in the genomes of viruses. The viruses infect cancer cells in culture and, after drug treatment, cells that survive (drug resistant) are harvested, their DNA is extracted and barcode DNA is detected (redrawn from Bhang et al. 2015).

Check this out!

Barcodes were pioneered by two young Americans, Bernard Silver and Norman Woodland, for automatically reading product information at checkouts and nowadays they’re used to mark everything from bananas to railway wagons and plane tickets. Their most familiar form is essentially a one-dimensional array that Woodland said he came up with by drawing Morse code in sand and just extending the dots and dashes to make narrow and wide lines.

120px-UPC-A-036000291452128px-PhotoTAN_mit_Orientierungsmarkierungen.svgbarcode n

 

 

 

 

Cellular barcoding uses the same idea but the ‘label’ is an artificial DNA sequence. Such is the power of the genetic code that a random string made up of 30 of its four distinct units (A, C, G & T) can essentially make an infinite number of different tags. Just like those on supermarket labels, two different codes look the same at first glance:

ACTCTGTGTCTCAGTGTGAGTGTCTGACTG

ACTGTCTGAGACAGAGAGTGTGACAGTCAG

The tags are made in an oligonucleotide synthesizer (a machine that sticks the units together) and then incorporated into virus backbones, just as we described for immunotherapy. The viruses (+ barcodes) then infect cells in culture, these are treated with a drug and the survivors present after a few weeks have their barcode DNAs sequenced. The deal here is that the number of different barcodes detected reflects the proportion of the original cell population that survived – and it indeed turned out that it’s very rare, pre-existing clones that are drug resistant. For one of the cell lines (derived from a human lung cancer) about one in 2,000 of the starting cell population showed resistance to the drug erlotinib.

Why?

The obvious question then is ‘What’s special about those few cells that they can thumb their noses at drugs that kill off most of their pals?’ To begin to get answers Bhang, Michor and colleagues noted that, for the lung cancer line, resistance to erlotinib occurs in cells that have multiple copies of a gene called MET – which makes a signalling protein. Exposing the cells to erlotinib and a MET inhibitor (crizotinib) greatly reduced the size of the resistant population (to one in 200,000).

This still leaves the question of the genetic alterations in that 0.0005% – and of course, finding drugs to target them. A further point is that this was a study of cells grown in the lab and it’s not possible to use this system in patients – but it could be used in mice to follow the development of implanted human tumours. If the causes of resistance can be tracked down it would open the way to using combinations of drugs that target both the bulk of tumour cells and the small sub-populations in which resistance lurks. That upshot would bring us to clinicians at the bedside (non-mathematicians!) – but not before running up a big debt to the maths geeks and in this case to a Viennese Dad who really did know best (offspring of the world please note!).

References

Bhang, H.C. et al. (2015). Studying clonal dynamics in response to cancer therapy using high-complexity barcoding. Nature Medicine 21, 440-448.

Gentlemen! For goodness’ sake …

I reckon there should be a 21st century addition to the family etiquette handbook banning laptops at the breakfast table. It’s anti-social and indeed downright rude: at best you get to your emails ten minutes quicker but it’s also really stupid because computers do not thrive on a diet of milkdrops, cornflake fragments and bits of toast. I never appear without mine – and with it I bring another potential, disgraceful side-effect, manifested in our household on the second day of the New Year when, a few minutes after I’d sat down, booted up and started munching, the air gradually began to turn blue. “Oh dear” muttered youngest son: “he’s on to the science pages of the broadsheets: fingers in ears.” How shrewd. And what good advice.

Rattling my cage

So what was it that so wound me up when I was looking forward to a rather non-sciency, tranquil opening to the year? “Most cancers are caused by bad luck not genes or lifestyle, say scientists”, a headline trumpeted by The Telegraph was a great start, backed-up by much the same parroted in The Independent and The Guardian. The only good news was that, try as I did, I could find no equivalent coverage in The New York Times or The Sydney Morning Herald. Let’s hear it for the colonials – or at least their science editors!

What’s my problem?

Why is it that this sort of journalism so annoys and certainly did so on further reading of those new year contributions? Well, partly because it’s headline-driven rather than a thoughtful effort to inform the public. And then because what’s propagated isn’t totally wrong – that would be easy to deal with – but rather it’s a confused mish-mash of half-truths guaranteed to confuse utterly anyone who doesn’t have an assured grip on their molecular wits.

Let’s get things clear

First let’s get the basic picture clear, then see what “the scientists” really said in this new piece of work and finally illustrate how the Gentlemen (and Gentlewomen) of the Press get me so incensed.

Asked to sketch a current cancer portrait one might say: Cancers are caused by damage to DNA, i.e. mutations. Of our 20,000 or so genes several hundred can acquire mutations that change the activity of the proteins they encode to contribute to cancer development. Only a small number (half a dozen or so) of these ‘driver’ mutations, acting together, are required for cancer to emerge. Thus almost limitless combinations of drivers can arise. The effect of these cancer ‘drivers’ is to make cells proliferate (i.e. divide to make more cells) either at a faster rate than normal, or at the wrong time or in an abnormal place. Environmental factors (e.g., smoking) can increase the mutation rate and hence the chance that cancers will evolve. Most mutations accumulate during the lifetime of the individual (hence most cancers are ‘diseases of old age’). However, about 10% of cancers are started by inherited mutations (that the patient is born with), with further mutations being acquired after birth.

We should also bear in mind that collectively cancer comprise about 200 distinct diseases and that at the level of DNA sequence every tumour is unique.

Pancreatic cancer cells

 

Cancer cells dividing. Photograph: Visuals Unlimited, Inc./Dr. Stanley Flegler.

 

 

 

What’s new?

The work that the journalists caught on to didn’t describe any new experiments but instead looked at the long-standing puzzle of why cancers, although able to arise anywhere in the body, have a strong tissue bias. For example, tumours are twenty times more common in the large intestine than in the small intestine.

Noting that within many tissues most cells are short-lived and don’t give rise to progeny (and so are unlikely to initiate a tumour), the authors focused on the cells that can self-renew and are therefore responsible for the continued existence and repopulation of the tissue (often called stem cells). Searching the literature, they found 31 tissue types for which it was possible to work out how many stem cell divisions occur in an average human lifetime. Lo and behold, it turned out that the number of divisions correlated quite well with the lifetime risk for cancer in that tissue type i.e. the more replications of stem cells that a tissue requires over its lifetime to sustain its functional, the greater the risk of a tumour emerging in that tissue.

An interpretation of this is that the majority of cancers arise (i.e. are started) as a result of random mutations occurring during DNA replication in normal, non-cancerous cells. The underlying point here is that every time one cell makes two it must first duplicate its genetic material (i.e. replicate its DNA). This process is amazingly efficient but it’s not perfect (cells make a mistake once for every one thousand million coding units (i.e. bases) incorporated into new DNA). In the abstract of their paper the authors describe cancers initiated by these naturally occurring mutations as “bad luck” – unfortunately in my view, as the expression was a sure-fire red rag to the press bulls.

A really irritating example

From The Telegraph: “For years health experts have warned that tumours are driven by a bad diet, lack of exercise, or gene errors passed down from parents… But now a study has shown that most cancers are primarily caused by bad luck rather than poor lifestyle choices or defective DNA.”

NO IT HASN’T. Do you not read what you’ve written and consider how it might come across to readers who think they’ve grasped the basic picture, as summarized above under Let’s get things clear?

What the study confirms is that the major force behind cancers is the accumulation of mutations (defective DNA if you wish) as cells replicate during the lifetime of the individual. To the risk of getting cancers posed by this background to life may be added environmental factors that promote DNA damage and inherited variants in DNA (see A Taxing Inheritance for more about parental contributions).

Is this really anything new?

Well, it’s marginal and certainly not enough to merit the above headlines. The new work doesn’t alter in any way our summary. However, it’s interesting in that it offers an explanation for the wide variation in cancer incidence across different tissues and makes the point, for instance, that the relatively high rate of cell renewal in the lung makes this organ particularly susceptible to the mutagenic effects of cigarette smoke.

So, what about luck?

First we remain as we were: cancers are a fact of life – they’re hard-wired into the biology of life and they’ll come to all of us if we live long enough.

It is certainly true that there are many cancer patients who have had bad luck. They may have always eaten healthily, kept active and physically fit and been teetotal since birth and yet be stricken by, for example, a brain tumour or pancreatic cancer for which there are no known environmental risk factors that we can do anything about. They may have never smoked but nonetheless develop lung cancer (think of Roy Castle).

But it remains the case that for many cancers, it isn’t just about luck, it’s about choices, both for society and for individuals. Mention of environmental factors reminds us that mankind really isn’t doing very well on the self-help front. Eliminating smoking would reduce the global cancer burden (14 million new cases, over 8 million deaths per year) by about 22%. Infections, for example from contaminated drinking water, start about 20% of all cancers whilst alcohol consumption has a hand in about 4% and in the UK over 20% of bowel cancers are linked to eating red and processed meat.

Calm down!

I know that for all the effect my wittering about the quality of science journalism will have I might as well get on to the sports pages. I actually have some sympathy with the Gentlemen of the Press: writing about science is difficult – perhaps we should rejoice that there’s any national coverage. But there is a recurrent problem in the British press (see Not another ‘Great Cancer Breakthrough’!!!) that can easily be avoided. Just report evolving science stories as precisely and clearly as possible. They’re often sensational tales in their own right, so leave the sensationalism to the other pages and tell it as it is.

Rant over. Happy new year. Now, where’s the marmalade?

References

Tomasetti, C. and Vogelstein, B. (2015). Variation in cancer risk among tissues can be explained by the number of stem cell divisions. Science 347, 78-81.