RoboClot

 

It was the Chinese, inevitably, who invented paper – during the Eastern Han period around 200 CE (or AD as I’d put it). Presumably by 201 AD some of the lads at the back of the class had discovered that this new stuff could be folded and launched to land on the desk of the local Confucius, generating much hilarity and presumably a few whacks with a bamboo cane.

Folding molecules

Not to be outdone some 21st century scholars have shown that you can do molecular origami with DNA. The idea is fairly simple: take a long strand of DNA (several thousand bases) and persuade it to fold into specific shapes by adding ‘staples’ — short bits of DNA (oligonucleotides). When you mix them together the staples and scaffold strands self-assemble in a single step. It’s pretty amazing but it’s driven by the simple concept of Watson-Crick base pairing (adenine (A) binds to thymine (T): guanine (G) to cytosine (C)).

These things are, of course, almost incomprehensibly small — they are biological molecules remember — each being a few nanometers long. Which means that you can plonk a billion on the head of a pin.

Working on this scale has given rise to the science of nanorobotics ­— making gadgets on a nanometre scale (10−9 meters or one thousandth of a millionth of a metre) and the gizmos themselves are nanorobots — nanobots to their friends.

Making parcels of DNA must be great fun but it’s not much use until you include the fact that you can stick protein molecules to your DNA carrier. If you choose a protein that has a known target, for example, something on the surface of a cell, you can now mail the parcels to an address within the body simply by injecting them into the circulation.

Molecular origami: Making a DNA parcel with a targeting protein. A bacteriophage is a virus that infects and replicates in bacteria, used here to make single strands of DNA. Short DNA ‘staples’ are designed to fold the scaffold DNA into specific shapes. Adding an aptamer (e.g., a protein that binds to a specific target molecule on a cell (an antigen)) permits targeting of the nanobot. When it sticks to a cell the package opens and the molecular payload is released (from Fu and Yan, 2012).

Open with care

Hao Yan and colleagues from Arizona State University have now taken nanobots a step further by adding a second protein to their targeted vehicle. For their targeting protein they used something that sticks to a protein present on the surface of cells that line the walls of blood vessels when they are proliferating (the target protein’s called nucleolin). Generally these (endothelial) cells aren’t proliferating so they don’t make nucleolin — and the nanobots pass them by. But growing tumours need to make their own blood supply. To do that they stimulate new vessels to sprout into the tumour (called angiogenesis) and this is what Hao Yan’s nanobots target.

As an anti-cancer tactic the nanobots carried a second protein: thrombin. This is a critical part of the process of coagulation by which damaged blood vessels set about repairing themselves. Thrombin’s role is to convert fibrinogen (circulating in blood) to fibrin strands, hence building up a blood clot to plug the hole. In effect the nanobots cause thrombosis, inducing a blood clot to block the supply line to the tumour.

Blood clotting (coagulation). Platelets form a plug strengthened by fibrin produced by the action of thrombin.

Does it work?

These DNA nanorobots showed no adverse effects either in mice or in Bama miniature pigs, which exhibit high similarity to humans in anatomy and physiology.

Fluorescently labeled nanobots did indeed target tumour blood vessels: the DNA wrapping opens when they attach to cells and the thrombin is released …

Fluorescent nanobots targetting tumour blood vessels (Li et al. 2018). The nanorobots have stuck to cells lining blood vessels (endothelial cells: green membrane) by attaching to nucleolin. After 8 hours the nanorobots (red) have been taken up by the cells and can be seen next to the nucleus (blue).

Most critically these little travellers did have effects on tumour growth. The localized thrombosis caused by the released thrombin resulted in significant tumour cell death and marked increase in the survival of treated mice.

Robotic DNA machines are now being referred to as ‘intelligent vehicles’ — a designation I’m not that keen on. Nevertheless, this is a cunning strategy, not least because, although much effort has gone into anti-angiogenic therapies for cancer, they have not been notably successful. Simply administering thrombin would presumably be fatal but, well wrapped up and correctly addressed, it seems to deliver.

Reference

Fu, J. and Yan, H. (2012). Controlled drug release by a nanorobot. Nature Biotechnology 30, 407-408.

Suping Li et al. (2018). A DNA nanorobot functions as a cancer therapeutic in response to a molecular trigger in vivo. Nature Biotechnology doi:10.1038/nbt.4071

Advertisements

A Word From The Nerds

I went (a long time ago it has to be admitted) to what people call an ‘old-fashioned’ grammar school. It wasn’t really old-fashioned – we didn’t wear wigs and frock coats – it just put great emphasis in getting its kids into good universities. To this end we were, at an early stage, split into scientists and the rest (aka arts students). It was a bit more severe even than that because the ‘scientists’ were sub-divided: those considered bright did Maths, Chemistry and Physics whilst the rest did Biology instead of Maths (or anything instead of Maths). All of which was consistent with the view that biologists – and that includes medics – could get by without being able to add up. That was a long time ago, of course, but to some extent the myth lives on. In tutorials with first year medical students I found an ace way of inducing nervous breakdowns was to ask them to do a sum in their heads (“Put that calculator away Biggs minor”).

But times do change and when I asked a doctor the other day which branches of medical science required maths, he paused for moment and then said “All of them.” By that he meant that pretty well every area of current research relies on the application of mathematics. We hear much about DNA sequencing, genomics and its various offshoots but all of these need ‘bioinformaticists’ (whizzos at sums) to extract the useful grains form the vast mass of data generated. Much the same may be said of research in what are called imaging techniques – developing methods of detecting tumours – and there is now a vast subject in itself of ‘systems biology’ in which mathematical modeling is applied to complex biological events (e.g., signalling within cells) with the aim of being able to reconstruct what goes on – what folk like to call a holistic approach. A variation on this theme is studying how large populations of cells behave – for example, tumour cells when exposed to an anti-cancer drug. And that’s an important matter: if your drug kills off every cancer cell bar one but that one happens to be very good at reproducing itself, before long you’ll be back to square one. The way to avoid going round in circles is to detect and interrogate individual survivor cells to find out why they are such good escape artists.

Girls will be girls

All of which brings us to Franziska Michor. Born in Vienna of a michor2-d5f528c0eec02b1797c3028e48c17598.pngmathematician father who, she has recounted, told her and her sister that they had either to study maths or marry a mathematician. Sounds a frightening version of tradition to me – and it had perhaps the intended effect on the girls: frantic sprints to the nearest Department of Mathematics. That’s a bit unfair. As they say, some of my best friends are mathematicians – so they’re not at all the stereotypical distrait, inarticulate, socially inept weirdos. Although most of them are.

But Fräulein Michor was clearly one of the exceptions. She’s now a professor at the Dana-Farber Cancer Institute and Harvard School of Public Health in Boston and, with colleagues, she’s had a go at an important question: when cancer cells become resistant to a drug, is it because they acquire new mutations in their DNA or is it that some cells are already resistant and they are the ones that survive and grow. Their results suggest the simple answer is ‘the latter’ – resistant clones are present before treatment and they’re the survivors. So the upshot is clear but the route to it was very clever – not least because the maths involved in teasing out the answer is positively frightening. Fortunately (medics breathe a sigh of relief!) we can ignore the horrors of ‘Stochastic mathematical modeling using a nonhomogeneous continuous-time multitype birth–death process’ – yes, really – and just look at the biology, which was ingenious enough. To get at the answer they developed a tagging system that tracked the individual fates of over one million barcoded cancer cells under drug treatment.

Nerd picBarcoding cells. Strings of DNA 30 base pairs in length and of random sequence are artificially synthesized (coloured bars). These fragments are inserted in the genomes of viruses. The viruses infect cancer cells in culture and, after drug treatment, cells that survive (drug resistant) are harvested, their DNA is extracted and barcode DNA is detected (redrawn from Bhang et al. 2015).

Check this out!

Barcodes were pioneered by two young Americans, Bernard Silver and Norman Woodland, for automatically reading product information at checkouts and nowadays they’re used to mark everything from bananas to railway wagons and plane tickets. Their most familiar form is essentially a one-dimensional array that Woodland said he came up with by drawing Morse code in sand and just extending the dots and dashes to make narrow and wide lines.

120px-UPC-A-036000291452128px-PhotoTAN_mit_Orientierungsmarkierungen.svgbarcode n

 

 

 

 

Cellular barcoding uses the same idea but the ‘label’ is an artificial DNA sequence. Such is the power of the genetic code that a random string made up of 30 of its four distinct units (A, C, G & T) can essentially make an infinite number of different tags. Just like those on supermarket labels, two different codes look the same at first glance:

ACTCTGTGTCTCAGTGTGAGTGTCTGACTG

ACTGTCTGAGACAGAGAGTGTGACAGTCAG

The tags are made in an oligonucleotide synthesizer (a machine that sticks the units together) and then incorporated into virus backbones, just as we described for immunotherapy. The viruses (+ barcodes) then infect cells in culture, these are treated with a drug and the survivors present after a few weeks have their barcode DNAs sequenced. The deal here is that the number of different barcodes detected reflects the proportion of the original cell population that survived – and it indeed turned out that it’s very rare, pre-existing clones that are drug resistant. For one of the cell lines (derived from a human lung cancer) about one in 2,000 of the starting cell population showed resistance to the drug erlotinib.

Why?

The obvious question then is ‘What’s special about those few cells that they can thumb their noses at drugs that kill off most of their pals?’ To begin to get answers Bhang, Michor and colleagues noted that, for the lung cancer line, resistance to erlotinib occurs in cells that have multiple copies of a gene called MET – which makes a signalling protein. Exposing the cells to erlotinib and a MET inhibitor (crizotinib) greatly reduced the size of the resistant population (to one in 200,000).

This still leaves the question of the genetic alterations in that 0.0005% – and of course, finding drugs to target them. A further point is that this was a study of cells grown in the lab and it’s not possible to use this system in patients – but it could be used in mice to follow the development of implanted human tumours. If the causes of resistance can be tracked down it would open the way to using combinations of drugs that target both the bulk of tumour cells and the small sub-populations in which resistance lurks. That upshot would bring us to clinicians at the bedside (non-mathematicians!) – but not before running up a big debt to the maths geeks and in this case to a Viennese Dad who really did know best (offspring of the world please note!).

References

Bhang, H.C. et al. (2015). Studying clonal dynamics in response to cancer therapy using high-complexity barcoding. Nature Medicine 21, 440-448.

Self Help – Part 2

In the second type of cancer immunotherapy a sample of a patient’s T lymphocytes is grown in the lab. This permits either expansion of the number of cells that recognize the tumour or genetic engineering to modify the cells so they express receptors on their surface that target them to the tumour cell surface. Infusion of these manipulated cells into the patient enhances tumour cell killing. We’re now in the realms of ‘personalized medicine’.

A little more of a good thing

The first of these methods picks up a weakness in the patient’s immune system whereby it makes lymphocytes that kill tumour cells but can’t make enough – their protective effect is overwhelmed by the growing cancer. By taking small pieces of surgically removed tumours and growing them in the lab, it’s possible to select those T cells that have killing capacity. These are expanded over a few weeks to make enough cells to keep on growing when they’re infused back into the patient. The upshot is a hefty boost for the natural anti-tumour defence system. The pioneer of this method, called adoptive cell therapy, is Steven Rosenberg (National Cancer Institute, Bethesda) and it has been particularly effective for melanomas. Responses are substantially improved by treatment with drugs that reduce the white cell count before samples are taken for T cell selection – probably because the system responds by making growth factors to restore the balance and these drive the expansion of the infused cells.

A wonderful benefit of this method is its efficacy against metastases – i.e. tumour growths that have spread from the primary site – perhaps not surprising as it’s what Rosenberg calls a “living” treatment, in other words it just gives a helping hand to what nature is already trying to do.

93. Fig. 1Selecting naturally occurring T cells with anti-tumour activity

Tumour fragments are grown in the laboratory: lymphocytes that kill tumour cells are selected and expanded in culture.  About 6 weeks growth yields enough cells to infuse into the patient.

Gene therapy

A more sophisticated approach to boosting innate immunity is to introduce new genes into the genetic material (the genome) of T cells to target them to tumour cells with greater efficiency. An ordinary blood sample suffices as a starting point from which T cells are isolated. One way of getting them to take up novel genes uses viruses – essentially just genetic material wrapped in an envelope. The virus is ‘disabled’ so that it has none of its original disease-causing capacity but retains infectivity – it sticks to cells. ‘Disabling’ means taking just enough of the original genome to make the virus – a viral skeleton – and then inserting your favourite gene, so the engineered form is just a handy vehicle for carrying genes. No need to panic, therefore, if you see a press headline of the “HIV cures cancer” variety: it just means that the human immunodeficiency virus – well and truly disabled – has been used as the gene carrier.

93. Fig. 2

Genetic modification of blood lymphocytes

T cells are isolated from a blood sample and novel genes inserted into their DNA. The engineered T cells are expanded and then infused into the patient.

 This method of re-directing T cells to a desired target was pioneered by Gideon Gross and colleagues at The Weizmann Institute of Science in Israel in the late 1980s and it has led to sensational recent results in treating chronic lymphocytic leukemia (CLL), albeit in just a few patients so far. To the fore have been Renier Brentjens and his group from the Memorial Sloan-Kettering Cancer Center, New York. The genetic modification they used made the patient’s T cells express an artificial receptor on their surface (called a chimeric antigen receptor). This T cell receptor was designed to stick specifically to a protein known to be displayed on the surface of CLL cells. The result was that the T cells, originally unable to ‘see’ the leukemic cells, now homed in on them with high efficiency. Astonishingly, and wonderfully, the modified cells divide in the patient so that, in effect, their immune system has been permanently super-charged.

A critical part of the strategy is that CLL cells carry a known molecular target but the absence of such defined markers for most cancers is currently a severe limitation. On the bright side, however, this type of gene therapy has now been attempted in at least three different centres and, despite inevitable minor differences in method, it clearly works.

One of the leading figures in gene therapy is Carl June of the University of Pennsylvania. Some of his colleagues have made a brilliant video explaining how it works whilst June himself has described in wonderfully humble fashion what it means to work in this field.

References

Rosenberg, S.A. and Restifo, N.P. (2015). Adoptive cell transfer as personalized immunotherapy for human cancer. Science 348, 62-68.

Gross, G., et al. (1989). Expression of immunoglobulin-T-cell receptor chimeric molecules as functional receptorswith antibody-type specificity. Proc. Natl. Acad. Sci. U.S.A. 86, 10024–10028.

Brentjens, R.J., et al. (2013). CD19-Targeted T Cells Rapidly Induce Molecular Remissions in Adults with Chemotherapy-Refractory Acute Lymphoblastic Leukemia. Sci Transl Med., 5, 177ra38. DOI:10.1126/scitranslmed.3005930.

Kalos, M., et al. (2011). T cells with chimeric antigen receptors have potent antitumor effects and can establish memory in patients with advanced leukemia. Sci. Transl. Med. 3, 95ra73.

Kochenderfer, J.N., et al. (2012). B-cell depletion and remissions of malignancy along with cytokine-associated toxicity in a clinical trial of anti-CD19 chimeric-antigen-receptor–transduced T cells. Blood 119, 2709–2720.

 

Heir of the Dog

I’ve probably in the past owned up to causing generations of students to do that raised eyebrow thing, familiar to all parents of teenagers, that, far more pointedly than words, says ‘The old boy’s finally lost it.’ Indeed I may well have a bit of a causative repertoire but one that unfailingly works is revealing that, even after a life in science, I still get ‘Wow’ moments every couple of months or so when I read or hear of some new discovery, method or insight that brings home yet again the wonder of Nature – or has you asking ‘Why didn’t I think of that?’ (The response to that one’s easy, by the way, so please don’t write in).

A common question

The most recent of these jaw-dropping events relates to a question often asked about cancer: ‘Can you catch it from someone else?’ In other words, can cancers be passed from one person to another by infection, much as happens with ’flu? The answer’s ‘No’ but, as usual in this field, even the firmest statement can do with a little explanation. The first point is that the ‘No’ is true even for 20% or so of cancers that are actually started by microbial infection – what you might call ‘bugs’ – bacteria, fungi, and viruses. One such, the bacterium Helicobacter pylori, can cause stomach ulcers that may lead to cancer. Those even smaller bugbears, viruses (typically one one-hundredth the size of a bacterium), are responsible for much of the cervical and liver cancer burden world-wide. Oh, and there’s a little, single-cell parasite (Trichomonas vaginalis), the most common non-viral, sexually transmitted infection in the world that, in men, can cause prostate cancer. But these infections are not cancers even though they may be an underlying cause – bacteria through prolonged inflammation and effects on the immune system and viruses by making proteins that affect how cells behave. Only when these perturbations cause genetic damage – i.e. DNA mutations – do you have a cancer. Which is why the answer to the original question is ‘No.’

There’s always one

Well, two in this case – and, given that we’re talking about cancer, you won’t be surprised that there are some oddities. They’re not exceptions to the ‘No’ answer because they occur in other animals – not in humans – but, in each, tumour cells are directly transferred from one creature to another – so it is cancer by infection. One such contagious tumour occurs in the Tasmanian devil. It’s transmitted by biting, an activity popular with these little chaps, and it gives rise to a particularly virulent facial tumor, eventually fatal because it prevents eating. To counter the probability that Tasmanian devils will become extinct in their native habitat, a number of Australian sanctuaries have breeding programmes aimed at setting up a disease-free colony on Kangaroo Island, South Australia.

TDs

Tas D

 

 

 

 

 

Tasmanian devils – cancer-free – Lone Pine Koala Sanctuary, Brisbane

A very similar condition in dogs known as canine transmissible venereal tumour (CTVT: also called Sticker’s sarcoma), mainly affects the external genitalia. First spotted in the nineteenth century by a Russian vet, it too is spread either by licking or biting and also through coitus. Dogs with CTVT can now be found on five continents and, from DNA analysis, we’ve known for some time that – remarkably – all their cancers are descended from a single, original tumour cell that appeared many years ago. They’re like one of those cell lines grown in labs all over the world, except they’ve been going far longer than any lab – with man’s best friend doing the cultivating.

So what is new?

Elizabeth Murchison and colleagues at The Wellcome Trust Sanger Institute, Cambridge have just produced the first whole-genome sequences of two of these tumours – from Australia and Brazil (an Aboriginal camp dog and a purebred American cocker spaniel). These confirmed that all CTVTs descend from a single ancestor who, they estimated, was trotting around about 11,000 years ago. The last common relative of the two dogs whose tumours were sequenced lived about 500 years ago, before his descendants went walkies to different continents.

And the ‘Wow’?

We already had a pretty good idea of how CTVTs have been handed down. In this paper the really amazing bit came in the detail. The authors estimated roughly how many mutations were present in each tumour. Answer: a staggering 1.9 million. And it’s staggering partly because it’s only slightly less than a change every 1,000 units (bases) in dog DNA but it’s truly awesome when you note that it’s several hundred times more than you find in most human cancers. We’re getting used to the idea of thousands or tens of thousands of mutations turning up in human cancer cells with associated gross disruptions of individual chromosomes. But these canine cancers display genetic mayhem on a massive scale – perhaps best visualized by comparing their chromosomes with those of a normal dog using a method that labels each with a different colour. A glance at the two pictures tells the story: all the cancer chromosomes from one of the tumour-bearing dogs (on the right) have been shuffled as if in some molecular card game. The full range of colours can still be seen, but of the normal pattern of 39 pairs of identical segments of DNA (left) there is no sign.

Two dogs chromos

Dog chromosomes. Left: normal; right: CTVT

(from Murchison, E.P. et al. (2014) Science 343, 437-440)

It seems incredible that cells can survive such a shattering of their genetic material – a state called ‘genetic instability’ because, once DNA damage sets in, mutations usually continue to accumulate. These cancers are uniquely bizarre, however, because although their genomes have been blown to smithereens, not only do the cells survive but they’ve continued suspended in this surreal state for centuries. They’re genetically stable – it really is the cellular equivalent of balancing an elephant on a pin.

‘Wow’ Indeed – but so what?

So like me you’ve been blown away by these discoveries but you may be asking, apart from the excitement, what’s in it for us humans? Well, there’s one other very strange thing about these dog cancers. Infected animals do indeed develop the most unpleasant, large tumours – but most of them are eventually rejected by the host dog. That is, its immune system gets to work to eliminate them – and after that the dog is immune to further infection. We are only just beginning to find ways of boosting the human immune system so that it can attack cancers and maybe, just maybe, we can extract from the stable chaos of the CTVT genome the secret of how they provoke rejection – and maybe that will guide human treatments.

Reference

Murchison, E.P. et al. (2014). Transmissible Dog Cancer Genome Reveals the Origin and History of an Ancient Cell Lineage. Science 343, 437-440.